Aphrophora corticea

Germar, 1821 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphrophoridae/Aphrophora

At a glance

Occurrence records735

Data sources6

Biological traits0

DNA specimens7

eDNA detections69

Sources6 archives

Databases and archives Aphrophora corticea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility735 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF735 records

Environmental DNA4 datasets · 5 countries69 detections

DNA & barcodingBOLD7 specimens

01Narrative

Kiefernschaumzikade Die Kiefernschaumzikade (Aphrophora corticea) gehört zu den Rundkopfzikaden (Cicadomorpha) aus der Familie der Schaumzikaden (Aphrophoridae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrophora corticea has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections69

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

232Amostly conserved

370Gmostly conserved

478Amostly conserved

TACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGAACAACCTTAAGATTATTAATTCGGGTAGAATTGGGTCAACCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrophora canadensissame genus6.8%Aphrophora permutatasame genus7.4%Aphrophora maculosasame genus7.4%Aphrophora fulvasame genus7.5%Aphrophora princepssame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type735 records

Wild obs. + sensor614

Museum / vouchered121

Origin

Native2

Range

Area of Occupancy AOO2 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 213≤1 km 138≤10 km 118>10 km 11

480 georeferenced · 134 without coordinates

Open the mapobservation + sensor614

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 98≤1 km 15≤10 km 3

116 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NHMOlocation not on record	48
SLU Artdatabankenlocation not on record	21
neflocation not on record	3
CIBIOlocation not on record	2
BioFokuslocation not on record	2

5 institutions · 76 of 121 vouchered records shown · 45 without an institution code

09Environmental DNA69 detections

Where the DNA of Aphrophora corticea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys4

Countries5

Verifiable raw sequence linked61

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map5 countries0

Pelouses sechesSport_and_leisure_facilities.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 10.9–16.6

Seasonal swing summer↔winter18.2 °C

Max temp (day)17.7 °C 14.2–20.7

Min temp (night)10.5 °C 8.60–13.1

Precipitation75.8 mm/mo 67.2–92.7

Air humidity61.6 % 59.2–66.2

Moisture balance-16.0 mm/mo -25.0–31.0

Vapour deficit624 Pa 439–770

Wind speed2.90 m/s 2.40–3.50

Cloud cover45.6 % 41.5–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)