Aphis sambuci

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records2 076

Data sources8

Biological traits0

DNA specimens444

eDNA detections957

Sources8 archives

Databases and archives Aphis sambuci's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 076 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI957 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics444 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS42 compounds

Occurrence & distributionGBIF2 076 records

Environmental DNA6 datasets · 18 countries957 detections

DNA & barcodingBOLD444 specimens

01Narrative

Eine Kolonie auf Schwarzem Holunder Ungeflügelte Weibchen der parthenogenetischen Generation Die Schwarze Holunderblattlaus (Aphis sambuci), auch Holunderblattlaus genannt, ist eine Art der Röhrenblattläuse und holarktisch verbreitet.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition42 compounds

Compounds documented for Aphis sambuci across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones15

Labdane diterpenoids5

Labdane diterpenoids $ Norlabdane diterpenoids2

Cinnamic acids and derivatives $ Phenylethanoids2

Hydrocarbons1

Documented compounds42 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,3R,4R,5R)-3,4-dihydroxy-5-methyl-2-propan-2-ylcyclohexane-1-carboxylic acid	present	NPASS
(1R,3R,4R,4aS,8S,8aR)-4-[2-(furan-3-yl)ethyl]-8-(hydroxymethyl)-3,4a,8-trimethyl-2,3,5,6,7,8a-hexahydro-1H-naphthalene-1,4-diol	present	NPASS
(1R,3S,4R,4aS,8S,8aS)-4-[2-(furan-3-yl)ethyl]-8-(hydroxymethyl)-3,4a,8-trimethyl-2,3,5,6,7,8a-hexahydro-1H-naphthalene-1,4-diol	present	NPASS
(1R,4S,8S,9R,10S,12R)-9-[2-(furan-3-yl)ethyl]-9-hydroxy-4,8,10-trimethyl-2-oxatricyclo[6.3.1.04,12]dodecan-3-one	present	NPASS
(2'R,2''aS,5''aS,6''R,7''R,8''aR,8''bR)-3',3'',4',4'',5'',5''a,7'',8'',8''a,8''b-Decahydro-2''a,5''a,7''-trimethyldispiro(furan-3(2H),2'(5'H)-furan-5',6''-(6H)naphtho(1,8-bc)furan)-2''(2''aH)-one	present	NPASS
[(2R)-1-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-1-oxopropan-2-yl] (2S,3S,4S,5R,6R)-3,4,5,6-tetrahydroxyoxane-2-carboxylate	present	NPASS
[(2R)-1-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxy-1-oxopropan-2-yl] (2S,3S,4S,5R,6R)-3,4,5,6-tetrahydroxyoxane-2-carboxylate	present	NPASS
[(2R,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl] (2R)-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropanoate	present	NPASS
[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl] (2R)-2-hydroxypropanoate	present	NPASS

05DNA & barcoding444 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis sambuci has left across the world's sequence archives.

At a glance

DNA specimens444

BINs2

Marker genes1

eDNA detections957

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus434 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

208Amostly conserved

487Cvariable

625Amostly conserved

TTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGATCTTCACTTAGAATTTTAATTCGATTAGAATTAAGTCAAATCAATTCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes22

BINs2

Most divergent pair1.8%

N.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis neospiraeaesame genus6.2%Aphis pentstemonicolasame genus6.4%Aphis fabaesame genus6.6%Aphis caroliboernerisame genus6.6%Aphis rumicissame genus6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 076 records

Wild obs. + sensor1 754

Museum / vouchered315

Other7

Range

Area of Occupancy AOO5 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 829≤1 km 240≤10 km 374>10 km 31

1 474 georeferenced · 280 without coordinates

Open the mapobservation + sensor1 754

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 26≤1 km 24≤10 km 60>10 km 10

120 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	145
Champaign, US	82
Essig Museum of Entomologylocation not on record	42
Adam Mickiewicz University in Poznańlocation not on record	13
South Kensington, GB	8
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
Ciudad de México, MX	2
Bavarian State Collection of Zoologylocation not on record	1
Natural History Museum, Londonlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
WIlocation not on record	1
Tartu, EE	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

13 institutions · 303 of 315 vouchered records shown · 12 without an institution code

09Environmental DNA957 detections

Where the DNA of Aphis sambuci was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found957

Studies independent surveys6

Countries18

Verifiable raw sequence linked180

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 957 detections have coordinates

Open the map18 countries0

1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland1.6. Subtropical/Tropical Moist Lowland Forest1.1. Boreal Forest|1. Forest & WoodlandUrbanMixed forest on sandy soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.0–15.0

Seasonal swing summer↔winter18.3 °C

Max temp (day)17.6 °C 16.2–19.1

Min temp (night)9.80 °C 7.90–12.2

Precipitation71.1 mm/mo 51.5–108

Air humidity59.4 % 57.0–61.3

Moisture balance-40.3 mm/mo -81.3–0.8

Vapour deficit632 Pa 598–731

Wind speed3.20 m/s 2.20–4.60

Cloud cover38.9 % 33.1–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 914 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphis sambuci

At a glance

Sources8 archives

Compound class profile5 classes

Documented compounds42 total

At a glance

Record type2 076 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 076 records