Aphis fabae

Scopoli, 1763 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records5 743

Data sources9

Biological traits0

DNA specimens843

eDNA detections2 065

Sources9 archives

Databases and archives Aphis fabae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 743 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 065 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics843 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF5 743 records

Environmental DNA6 datasets · 38 countries2 065 detections

DNA & barcodingBOLD843 specimens

Genome at a glanceGoaT · NCBI597 Mbp

01Narrative

Le puceron noir de la fève est une espèce de petits insectes de l'ordre des hémiptères, de la famille des aphididés, qui parasite de nombreuses plantes cultivées. Ses dégâts sont souvent aggravés par la production de fumagine due au miellat sécrété par les pucerons.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition12 compounds

Compounds documented for Aphis fabae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Carotenoids (C40, β-β)5

Carotenoids (C40, Ψ-Ψ)2

Carotenoids (C40, β-Ψ)1

Disaccharides $ Polysaccharides1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Melezitose	present	NPASS
(2R,3R,4R,5R,6S)-2-[(3S,4E,6E,8E,10E,12E,14E,16E,18E,20E,22E,24E,26E,28E,30S)-2,31-dihydroxy-2,6,10,14,19,23,27,31-octamethyl-30-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxydotriaconta-4,6,8,10,12,14,16,18,20,22,24,26,28-tridecaen-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3S,4R,5S,6R)-2-[(3S,4E,6E,8E,10E,12E,14E,16E,18E,20E,22E,24E)-2-hydroxy-25-[(4S)-4-hydroxy-2,6,6-trimethylcyclohexen-1-yl]-2,6,10,14,19,23-hexamethylpentacosa-4,6,8,10,12,14,16,18,20,22,24-undecaen-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3S,4S,5S,6R)-2-[(3S,4E,6E,8E,10E,12E,14E,16E,18E,20E,22E,24E,26E,28E,30S)-2,31-dihydroxy-2,6,10,14,19,23,27,31-octamethyl-30-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxydotriaconta-4,6,8,10,12,14,16,18,20,22,24,26,28-tridecaen-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol	present	NPASS
(3S,3'S,all-E)-Zeaxanthin	present	NPASS
3'-Hydroxyechinenone	present	NPASS
beta-Carotene	present	NPASS
Echinenone	present	NPASS
MUCOHWBULSBLLZ-SPWDEXBKSA-N	present	NPASS

05DNA & barcoding843 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis fabae has left across the world's sequence archives.

At a glance

DNA specimens843

BINs2

Marker genes3

eDNA detections2 065

Countries38

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus821 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

499Cmostly conserved

AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGATCTTCACTTAGAATTTTAATTCGATTAGAATTAAGACAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes22

BINs2

Most divergent pair1.7%

EuropeN.AmericaAsiaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis rumicissame genus3.5%Aphis neospiraeaesame genus4.2%Aphis galiiscabrisame genus4.6%Aphis acetosaesame genus5.3%Aphis caroliboernerisame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_039988 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphis fabae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size596 580 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphis fabae0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type5 743 records

Wild obs. + sensor4 333

Museum / vouchered1 401

Other9

Origin

Native1

Introduced50

Range

Area of Occupancy AOO9 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 826≤1 km 1 756≤10 km 851>10 km 21

3 454 georeferenced · 879 without coordinates

Open the mapobservation + sensor4 333

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 110≤1 km 77≤10 km 357>10 km 45

589 georeferenced · 812 without coordinates

Open the institutions mapphysical evidence1 401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Essig Museum of Entomologylocation not on record	362
Copenhagen, DK	356
Champaign, US	248
Adam Mickiewicz University in Poznańlocation not on record	78
UAclocation not on record	65
University of Guelph, Centre for Biodiversity Genomicslocation not on record	43
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	23
WIlocation not on record	20
East Lansing, US	5
DPIlocation not on record	5
Ciudad de México, MX	2
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
US	1
University Park, US	1
Tartu, EE	1
Helsinki, FI	1

17 institutions · 1 213 of 1 401 vouchered records shown · 181 without an institution code

09Environmental DNA2 065 detections

Where the DNA of Aphis fabae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 065

Studies independent surveys6

Countries38

Verifiable raw sequence linked255

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 065 detections have coordinates

Open the map38 countries0

WetlandMixed habitat4. Native Grassland|4.6. Subtropical/Tropica…GrasslandUrbanForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.6–18.6

Seasonal swing summer↔winter16.7 °C

Max temp (day)18.5 °C 15.0–23.1

Min temp (night)11.1 °C 7.10–14.6

Precipitation67.8 mm/mo 46.4–104

Air humidity60.3 % 56.9–63.0

Moisture balance-47.2 mm/mo -72.9–13.5

Vapour deficit665 Pa 524–896

Wind speed3.60 m/s 2.20–4.90

Cloud cover41.6 % 33.2–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 1 666 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphis fabae

At a glance

Sources9 archives

Compound class profile4 classes

Documented compounds12 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type5 743 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 743 records