Aphis pentstemonicola

Gillette & Palmer, 1929 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records30

Data sources5

Biological traits0

DNA specimens10

eDNA detections12

Sources5 archives

Databases and archives Aphis pentstemonicola's data was compiled from.

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis pentstemonicola has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

103Cmostly conserved

271Amostly conserved

529Tmostly conserved

622Amostly conserved

AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGATCTTCACTTAGAATTCTAATTCGATTAGAATTAAGTCAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis neospiraeaesame genus4.9%Aphis chaetosiphonsame genus5.0%Aphis caliginosasame genus5.0%Aphis rumicissame genus5.2%Braggia eriogonisame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor1

Museum / vouchered29

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
WIlocation not on record	1

3 institutions · 20 of 29 vouchered records shown · 9 without an institution code

09Environmental DNA12 detections

Where the DNA of Aphis pentstemonicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

GrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 6.10–16.2

Seasonal swing summer↔winter23.2 °C

Max temp (day)18.8 °C 11.4–23.2

Min temp (night)6.10 °C 0.8–10.8

Precipitation79.9 mm/mo 66.3–122

Air humidity53.5 % 52.6–59.3

Moisture balance-51.2 mm/mo -63.6–1.00

Vapour deficit663 Pa 384–882

Wind speed2.40 m/s 2.40–2.70

Cloud cover37.1 % 31.4–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)