Apethymus serotinus

(O.F.Müller, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Apethymus

At a glance

Occurrence records350

Data sources7

Biological traits0

DNA specimens20

eDNA detections19

Sources7 archives

Databases and archives Apethymus serotinus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility350 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF350 records

Environmental DNA3 datasets · 3 countries19 detections

DNA & barcodingBOLD20 specimens

01Narrative

Apethymus serotinus is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apethymus serotinus has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 96 variable positions, in barcode order

3Tmostly conserved

4Amostly conserved

6Amostly conserved

8Tmostly conserved

11Amostly conserved

14Tmostly conserved

15Tmostly conserved

16Tmostly conserved

17Gmostly conserved

18Gmostly conserved

19Amostly conserved

21Tmostly conserved

22Tmostly conserved

24Gmostly conserved

26Tmostly conserved

27Cmostly conserved

29Gmostly conserved

30Gmostly conserved

32Amostly conserved

35Cvariable

36Tmostly conserved

38Gmostly conserved

39Gmostly conserved

41Cvariable

42Tmostly conserved

45Cmostly conserved

46Amostly conserved

47Tmostly conserved

48Tmostly conserved

49Tmostly conserved

51Gmostly conserved

53Amostly conserved

56Tmostly conserved

58Amostly conserved

59Amostly conserved

60Tmostly conserved

61Tmostly conserved

62Cmostly conserved

63Gmostly conserved

65Amostly conserved

66Tmostly conserved

68Gmostly conserved

69Amostly conserved

71Cmostly conserved

72Tmostly conserved

73Amostly conserved

74Gmostly conserved

75Gmostly conserved

76Tmostly conserved

77Amostly conserved

78Tmostly conserved

79Amostly conserved

80Cmostly conserved

81Cmostly conserved

82Tmostly conserved

83Gmostly conserved

84Gmostly conserved

85Amostly conserved

87Cmostly conserved

88Tvariable

89Tmostly conserved

91Amostly conserved

92Amostly conserved

93Tmostly conserved

94Tmostly conserved

95Gmostly conserved

96Gmostly conserved

97Amostly conserved

98Amostly conserved

100Tmostly conserved

103Cvariable

109Gvariable

160Avariable

175Cvariable

184Cvariable

209Tvariable

214Gvariable

232Tvariable

268Tvariable

319Avariable

364Tvariable

400Tvariable

404Tvariable

424Tvariable

430Avariable

472Avariable

481Cvariable

482Cvariable

493Amostly conserved

511Tvariable

536Cmostly conserved

547Tvariable

559Avariable

634Avariable

643Tvariable

649Cmostly conserved

ATTATATTTTATTTTTGGATTTTGATCAGGAATACTAGGACTATCATTTAGAATATTAATTCGAATAGAACTAGGTATACCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes5

BINs2

Most divergent pair4.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apethymus filiformissame genus8.6%Apethymus cereussame genus9.0%Claremontia unctasame family12.3%Ametastegia recenssame family12.6%Euura dissimilissame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type350 records

Wild obs. + sensor291

Museum / vouchered59

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 119≤1 km 79≤10 km 50>10 km 2

250 georeferenced · 41 without coordinates

Open the mapobservation + sensor291

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 16≤1 km 3≤10 km 6

25 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	14
SLU Artdatabankenlocation not on record	7
Zürich, CH	6
Tilburg, NL	5
ZSMlocation not on record	4
NHMOlocation not on record	4
Stockholm, SE	3
Gothenburg, SE	2
BioFokuslocation not on record	2
Institute of Zoology Slovak Academy of Scienceslocation not on record	1
Wellcome Sanger Institutelocation not on record	1
neflocation not on record	1

12 institutions · 50 of 59 vouchered records shown · 9 without an institution code

09Environmental DNA19 detections

Where the DNA of Apethymus serotinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys3

Countries3

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.3–16.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.7 °C 13.2–20.7

Min temp (night)10.4 °C 6.10–12.8

Precipitation63.0 mm/mo 58.1–72.2

Air humidity61.2 % 61.0–64.2

Moisture balance-20.8 mm/mo -35.3–6.90

Vapour deficit628 Pa 479–724

Wind speed2.80 m/s 2.30–3.70

Cloud cover45.6 % 38.8–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)