Apethymus filiformis

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Apethymus

At a glance

Occurrence records394

Data sources6

Biological traits0

DNA specimens26

eDNA detections4

Sources6 archives

Databases and archives Apethymus filiformis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF394 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD26 specimens

01Narrative

Apethymus filiformis ist eine Pflanzenwespe aus der Familie der Echten Blattwespen (Tenthredinidae). Die Art wurde von dem deutschen Entomologen Johann Christoph Friedrich Klug im Jahr 1818 erstbeschrieben. Das lateinische Art-Epitheton filiformis bedeutet „fadenförmig“ und bezieht sich offenbar auf die relativ langen schlanken Fühler.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apethymus filiformis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

292Amostly conserved

316Amostly conserved

322Gmostly conserved

517Tmostly conserved

550Amostly conserved

637Tmostly conserved

TACATTATATTTTATTTTTGGATTTTGATCTGGAATATTAGGACTATCATTTAGTATACTTATTCGAATAGAACTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apethymus serotinussame genus8.6%Ametastegia apertasame family10.8%Allantus didymussame family11.6%Ametastegia albipessame family11.6%Claremontia alchemillaesame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type394 records

Wild obs. + sensor176

Museum / vouchered218

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 80≤1 km 43≤10 km 32>10 km 3

158 georeferenced · 18 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 2≤1 km 3≤10 km 202

207 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	184
ZSMlocation not on record	4
ZMAAlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Oulu, FI	1
NHMOlocation not on record	1
Tilburg, NL	1
MZLUlocation not on record	1

8 institutions · 196 of 218 vouchered records shown · 22 without an institution code

09Environmental DNA4 detections

Where the DNA of Apethymus filiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 10.4–16.4

Seasonal swing summer↔winter23.5 °C

Max temp (day)20.4 °C 14.8–21.8

Min temp (night)11.1 °C 7.20–11.1

Precipitation94.5 mm/mo 73.1–124

Air humidity56.5 % 55.5–62.8

Moisture balance-4.00 mm/mo -32.2–23.5

Vapour deficit765 Pa 484–833

Wind speed3.50 m/s 2.70–3.60

Cloud cover43.1 % 41.9–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)