Apethymus cereus

(Klug, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Tenthredinidae/Apethymus

At a glance

Occurrence records35

Data sources6

Biological traits0

DNA specimens6

eDNA detections1

Sources6 archives

Databases and archives Apethymus cereus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Seitenansicht, Mesopleuron und Sägescheide erkennbar Ventralansicht Flügel Larve, vermutlich von Apethymus cereus Apethymus cereus ist eine Pflanzenwespe aus der Familie der Echten Blattwespen (Tenthredinidae). Die Art wurde von dem deutschen Entomologen Johann Christoph Friedrich Klug im Jahr 1818 als Tenthredo cerea erstbeschrieben. Bis zur Revision der Gattung Apethymus durch Koch im Jahr 1988 galt die Pflanzenwespe unter der Bezeichnung Apethymus abdominalis var. cereus (, 1818) als eine Farbvariante von Apethymus filiformis. Das lateinische Art-Epitheton cereus bedeutet „wachsfarben“.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apethymus cereus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)3.8%

Haplotypes2

BIN1

Most divergent pair8.1%

Where individuals differ — all 56 variable positions, in barcode order

31Avariable

35Tmostly conserved

41Cmostly conserved

49Tmostly conserved

52Tmostly conserved

64Amostly conserved

76Amostly conserved

82Tvariable

100Tmostly conserved

103Tmostly conserved

107Tmostly conserved

124Cvariable

181Amostly conserved

194Cvariable

199Cvariable

202Amostly conserved

209Tmostly conserved

211Amostly conserved

235Cmostly conserved

239Cmostly conserved

262Tmostly conserved

268Amostly conserved

298Amostly conserved

307Cmostly conserved

312Gmostly conserved

322Avariable

325Amostly conserved

334Amostly conserved

337Tvariable

340Avariable

346Tmostly conserved

364Cmostly conserved

394Cmostly conserved

398Tmostly conserved

403Cvariable

433Tmostly conserved

471Tmostly conserved

508Amostly conserved

511Amostly conserved

514Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Cmostly conserved

541Tmostly conserved

547Avariable

553Amostly conserved

571Amostly conserved

575Tmostly conserved

578Cmostly conserved

586Cvariable

592Cmostly conserved

619Amostly conserved

622Gvariable

631Tmostly conserved

634Tmostly conserved

643Cmostly conserved

ATTATATTTTATTTTTGGATTTTGATCTGGAATATTAGGACTATCATTTAGTATACTTATTCGAATAGAACTAGGAATACCTGGATCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apethymus serotinussame genus9.0%Ametastegia apertasame family11.5%Allantus didymussame family11.9%Allantus laticinctussame family12.2%Allantus ariadnesame family12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type35 records

Wild obs. + sensor23

Museum / vouchered12

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 5≤1 km 3≤10 km 14

22 georeferenced · 1 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	4
Tilburg, NL	2
Institute of Zoology Slovak Academy of Scienceslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
University of Edinburghlocation not on record	1

5 institutions · 9 of 12 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Apethymus cereus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 12.0–12.0

Seasonal swing summer↔winter11.8 °C

Max temp (day)14.4 °C

Min temp (night)7.60 °C

Precipitation70.4 mm/mo

Air humidity62.8 %

Moisture balance-28.2 mm/mo

Vapour deficit519 Pa

Wind speed3.50 m/s

Cloud cover52.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)