Apamea vultuosa

Grote, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records281

Data sources7

Biological traits0

DNA specimens49

eDNA detections51

Sources7 archives

Databases and archives Apamea vultuosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD49 specimens

01Narrative

Apamea vultuosa, the airy apamea, is a moth of the family Noctuidae native to North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea vultuosa has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

58Avariable

73Avariable

160Gvariable

364Tmostly conserved

511Avariable

562Avariable

601Cvariable

AACATTATATTTTATCTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes6

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea crenatasame genus3.0%Apamea ferragosame genus3.7%Apamea cogitatasame genus4.0%Apamea devastatorsame genus4.1%Apamea longulasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type281 records

Wild obs. + sensor109

Museum / vouchered172

Range

Area of Occupancy AOO692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 68≤1 km 13≤10 km 2>10 km 9

92 georeferenced · 17 without coordinates

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 16≤10 km 22

39 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	31
Oregon State Arthropod Collectionlocation not on record	24
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
New Haven, US	13
East Lansing, US	12
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
St. Paul, US	6
Brussels, BE	4
Royal Saskatchewan Museumlocation not on record	3
ASUlocation not on record	2
Cambridge, US	1
National Institute of Biological Resourceslocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Toronto, CA	1
WWUlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
SOVTlocation not on record	1

17 institutions · 126 of 172 vouchered records shown · 46 without an institution code

09Environmental DNA51 detections

Where the DNA of Apamea vultuosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

Mixed habitat1. Forest & Woodland|1.1. Boreal Forest1. Forest & WoodlandForest5. Wetlands (inland)1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 11.9–18.0

Seasonal swing summer↔winter10.9 °C

Max temp (day)18.4 °C 13.9–23.5

Min temp (night)11.9 °C 7.40–13.4

Precipitation67.5 mm/mo 35.4–102

Air humidity60.3 % 55.3–63.2

Moisture balance-70.2 mm/mo -93.7–-15.5

Vapour deficit634 Pa 546–888

Wind speed3.60 m/s 2.60–4.40

Cloud cover41.0 % 31.7–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)