Apamea platinea

(Treitschke, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records1 365

Data sources6

Biological traits0

DNA specimens24

eDNA detections23

Sources6 archives

Databases and archives Apamea platinea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 365 records

Environmental DNA1 datasets · 5 countries23 detections

DNA & barcodingBOLD24 specimens

01Narrative

Apamea platinea is een vlinder uit de familie uilen (Noctuidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1825 door Treitschke. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea platinea has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections23

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

37Avariable

212Tmostly conserved

287Tmostly conserved

307Amostly conserved

AACATTATATTTTATTTTTGGGATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTAATAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes6

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea furvasame genus3.2%Apamea devastatorsame genus3.3%Margelana versicolorsame family4.0%Apamea ferragosame genus4.0%Apamea longulasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 365 records

Wild obs. + sensor449

Museum / vouchered809

Other107

Origin

Native428

Range

Area of Occupancy AOO1 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 61≤1 km 76≤10 km 269>10 km 4

410 georeferenced · 39 without coordinates

Open the mapobservation + sensor449

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 43≤1 km 166≤10 km 559>10 km 4

772 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence809

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	139
Zürich, CH	88
Bern, CH	77
Salzburg, AT	51
Paro, BT	39
SFRAlocation not on record	39
Archäologie und Museum Baselland - Museum.BLlocation not on record	33
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	31
Geneva, CH	29
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	23
Sion, CH	17
UMUlocation not on record	16
Dhaka, BD	15
Musee d'Histoire Naturallelocation not on record	9
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
Universität Zürich, Naturhistorisches Museumlocation not on record	6
Naturama Aargaulocation not on record	6
Uniwersytet Łódzkilocation not on record	5
Fribourg, CH	5
Glarus, CH	4
Naturmuseum St. Gallenlocation not on record	4
Naturmuseum Oltenlocation not on record	4
Muzeum Górnośląskie w Bytomiulocation not on record	3
Winterthur, CH	3
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
ННПМ НАНУlocation not on record	1
John May Museum of Natural Historylocation not on record	1
ZSMlocation not on record	1
Naturmuseum Suedtirollocation not on record	1

29 institutions · 660 of 809 vouchered records shown · 149 without an institution code

09Environmental DNA23 detections

Where the DNA of Apamea platinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 8.20–17.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)16.9 °C 13.0–22.4

Min temp (night)6.20 °C 1.80–12.8

Precipitation104 mm/mo 52.7–184

Air humidity59.0 % 53.7–61.6

Moisture balance-27.6 mm/mo -106–63.1

Vapour deficit571 Pa 461–982

Wind speed2.80 m/s 1.80–7.80

Cloud cover37.2 % 33.6–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apamea platinea

At a glance

Sources6 archives

At a glance

Record type1 365 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 365 records