Apamea niveivenosa

Grote, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records421

Data sources6

Biological traits0

DNA specimens22

eDNA detections22

Sources6 archives

Databases and archives Apamea niveivenosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF421 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD22 specimens

01Narrative

Apamea niveivenosa, the snowy-veined apamea, is a moth of the family Noctuidae. The species was first described by Augustus Radcliffe Grote in 1879. It is native to northern North America, where it can be found across Canada and south to California."Apamea niveivenosa (Grote. 1879)". Pacific Northwest Moths. Retrieved November 14, 2020. The forewing length is 15 to 18 millimeters. Most moths are an ochre to orange-tan color, but a form in eastern British Columbia is dark gray with lighter gray lines and spots. The larva is a subterranean cutworm that feeds on grasses. It is a pest of grain crops in interior North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea niveivenosa has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

16Cmostly conserved

20Gmostly conserved

22Amostly conserved

24Tmostly conserved

268Gmostly conserved

AACATTGTATTTTATCTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea contradictasame genus3.2%Apamea kuusamoensissame genus3.3%Apamea cogitatasame genus3.5%Apamea zetasame genus3.6%Apamea oblongasame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type421 records

Wild obs. + sensor110

Museum / vouchered311

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 48≤1 km 19≤10 km 22>10 km 8

97 georeferenced · 13 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 42≤1 km 1≤10 km 17>10 km 11

71 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence311

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	112
St. Paul, US	64
Colorado State Universitylocation not on record	48
Royal Saskatchewan Museumlocation not on record	28
New Haven, US	23
Helsinki, FI	9
Mississippi State, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cambridge, US	2
Brussels, BE	2
East Lansing, US	2
Vernal, US	1
RBINS-Scientific Heritagelocation not on record	1

13 institutions · 302 of 311 vouchered records shown · 9 without an institution code

09Environmental DNA22 detections

Where the DNA of Apamea niveivenosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

GrasslandMixed HabitatForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 14.2–21.2

Seasonal swing summer↔winter23.5 °C

Max temp (day)23.9 °C 21.8–29.4

Min temp (night)10.9 °C 6.50–13.6

Precipitation45.0 mm/mo 12.9–73.5

Air humidity50.6 % 43.9–53.7

Moisture balance-114 mm/mo -176–-57.0

Vapour deficit964 Pa 767–1,422

Wind speed2.60 m/s 2.30–4.40

Cloud cover31.7 % 13.3–35.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)