Apamea maxima

Dyar, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records87

Data sources7

Biological traits0

DNA specimens22

eDNA detections23

Sources7 archives

Databases and archives Apamea maxima's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF87 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD22 specimens

01Narrative

Apamea maxima is a moth of the family Noctuidae. It is native to western North America, where it is found from British Columbia to California.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea maxima has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGGGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.03%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea oblongasame genus3.6%Apamea ferragosame genus3.8%Margelana versicolorsame family4.3%Arenostola unicolorsame family4.3%Apamea cogitatasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type87 records

Wild obs. + sensor17

Museum / vouchered70

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 5≤1 km 1≤10 km 1

7 georeferenced · 10 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤1 km 26≤10 km 3

29 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	28
University of Alberta Museums (UAM)location not on record	14
Oregon State Arthropod Collectionlocation not on record	8
Essig Museum of Entomologylocation not on record	3
Vernal, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Colorado State Universitylocation not on record	1

7 institutions · 57 of 70 vouchered records shown · 13 without an institution code

09Environmental DNA23 detections

Where the DNA of Apamea maxima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

bog forest, cedar-salal forest, zonal forestsand dune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.2–15.8

Seasonal swing summer↔winter10.1 °C

Max temp (day)16.8 °C 14.7–21.0

Min temp (night)10.7 °C 10.1–12.9

Precipitation93.9 mm/mo 36.8–158

Air humidity66.0 % 58.5–67.7

Moisture balance-26.3 mm/mo -106–43.4

Vapour deficit536 Pa 482–644

Wind speed4.30 m/s 1.50–4.50

Cloud cover38.7 % 31.6–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)