Apamea cuculliformis

Grote, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Apamea

At a glance

Occurrence records144

Data sources7

Biological traits0

DNA specimens12

eDNA detections13

Sources7 archives

Databases and archives Apamea cuculliformis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF144 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD12 specimens

01Narrative

Apamea cuculliformis is a moth of the family Noctuidae. It is found in western North America, including California, Washington and British Columbia. This wingspan is about 43 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apamea cuculliformis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

7Amostly conserved

217Amostly conserved

518Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGACTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea devastatorsame genus4.4%Apamea longulasame genus4.6%Apamea oblongasame genus4.6%Margelana versicolorsame family4.6%Apamea ferragosame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type144 records

Wild obs. + sensor48

Museum / vouchered96

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 14≤1 km 13≤10 km 2>10 km 5

34 georeferenced · 14 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 9≤1 km 2≤10 km 19>10 km 10

40 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	15
San Diego, US	13
University of Alberta Museums (UAM)location not on record	13
Oregon State Arthropod Collectionlocation not on record	13
Colorado State Universitylocation not on record	12
New Haven, US	8
San Francisco, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
University of California, Davis, Bohart Museum of Entomologylocation not on record	2
WWUlocation not on record	2
East Lansing, US	2
University of California, Davislocation not on record	1
Essig Museum of Entomologylocation not on record	1

13 institutions · 88 of 96 vouchered records shown · 8 without an institution code

09Environmental DNA13 detections

Where the DNA of Apamea cuculliformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.0–18.0

Seasonal swing summer↔winter10.9 °C

Max temp (day)23.2 °C 14.3–26.8

Min temp (night)10.3 °C 8.30–12.7

Precipitation8.40 mm/mo 0.9–41.5

Air humidity60.5 % 45.9–61.0

Moisture balance-142 mm/mo -158–-74.4

Vapour deficit753 Pa 552–1,089

Wind speed2.10 m/s 1.80–3.70

Cloud cover31.7 % 11.8–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)