Anthracus consputus

(Duftschmid, 1812) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anthracus

At a glance

Occurrence records2 231

Data sources6

Biological traits2

DNA specimens26

eDNA detections26

Sources6 archives

Databases and archives Anthracus consputus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 231 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 231 records

Environmental DNA1 datasets · 5 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

De oeverbontloper is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort werd in 1812 gepubliceerd door Caspar Erasmus Duftschmid.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthracus consputus has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes3

eDNA detections26

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

19Tmostly conserved

184Gmostly conserved

316Amostly conserved

328Gmostly conserved

373Amostly conserved

542Tmostly conserved

AACTTTATATTTTATTTTTGGTGTGTGAGCAGGAATAGTAGGAACTTCTTTAAGAATATTAATTCGAGCTGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes5

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bradycellus leconteisame family10.0%Acupalpus partiariussame family10.6%Acupalpus indistinctussame family10.6%Acupalpus eleganssame family10.6%Lachnophorus elegantulussame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 231 records

Wild obs. + sensor1 824

Museum / vouchered389

Cultivated / captive1

Fossil10

Other7

Origin

Native33

Range

Area of Occupancy AOO4 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 459≤1 km 363≤10 km 751>10 km 8

1 581 georeferenced · 243 without coordinates

Open the mapobservation + sensor1 824

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 44≤1 km 129≤10 km 106>10 km 4

283 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence389

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	110
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	30
Vitoria, ES	28
Tilburg, NL	18
Natural History Museum Rotterdamlocation not on record	16
Uniwersytet Wrocławskilocation not on record	14
ZSMlocation not on record	12
Copenhagen, DK	11
Tallinn, EE	10
Geneva, CH	9
Helsinki, FI	7
Tartu, EE	5
MZLUlocation not on record	5
Bern, CH	4
Muzeum Górnośląskie w Bytomiulocation not on record	3
NTNU-VMlocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
TMPMlocation not on record	1
CBDClocation not on record	1
�� ͳ�� -��location not on record	1
NCMGlocation not on record	1
Nijmegen, NL	1
Naturalis Biodiversity Centerlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

24 institutions · 294 of 389 vouchered records shown · 95 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA26 detections

Where the DNA of Anthracus consputus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map5 countries0

Auwaldrest1. Forest & Woodland | 1.4. Temperate ForestUferwiese

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 6.10–20.2

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.5 °C 9.80–24.7

Min temp (night)11.3 °C 2.10–15.3

Precipitation67.6 mm/mo 49.2–77.6

Air humidity58.9 % 56.8–61.5

Moisture balance-43.2 mm/mo -73.2–10.9

Vapour deficit673 Pa 370–1,031

Wind speed3.40 m/s 2.60–4.10

Cloud cover36.3 % 32.9–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthracus consputus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type2 231 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 231 records