Anthophylax cyaneus

(Haldeman, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anthophylax

At a glance

Occurrence records260

Data sources6

Biological traits0

DNA specimens12

eDNA detections11

Sources6 archives

Databases and archives Anthophylax cyaneus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF260 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anthophylax cyaneus is the species of the Lepturinae subfamily in long-horned beetle family.BioLib Taxon profile — species Anthophylax cyaneus (Haldeman, 1847) This beetle is distributed in Canada, and United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophylax cyaneus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

38Gmostly conserved

AACTTTATATTTCATTTTTGGCGCATGGGCAAGAATGGTGGGAACATCCCTCAGAATATTAATTCGATCTGAATTGGGGAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophylax viridissame genus9.6%Neanthophylax mirificussame family13.1%Arhopalus productussame family14.4%Rhagium mordaxsame family15.3%Drosophila macrospinasame order16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type260 records

Wild obs. + sensor229

Museum / vouchered31

Range

Area of Occupancy AOO944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 114≤1 km 45≤10 km 17>10 km 18

194 georeferenced · 35 without coordinates

Open the mapobservation + sensor229

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 11

11 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint John, CA	9
SOVTlocation not on record	6
University Park, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Toronto, CA	2
Cornell University Insect Collectionlocation not on record	2
University of Guelphlocation not on record	1
University of Central Floridalocation not on record	1
Champaign, US	1

9 institutions · 29 of 31 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Anthophylax cyaneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 5.60–16.4

Seasonal swing summer↔winter31.5 °C

Max temp (day)18.1 °C 8.40–21.4

Min temp (night)11.1 °C 3.40–11.6

Precipitation127 mm/mo 92.4–136

Air humidity56.6 % 56.6–64.6

Moisture balance3.00 mm/mo

Vapour deficit649 Pa 354–807

Wind speed2.80 m/s

Cloud cover48.2 % 43.8–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)