Anthophylax viridis

LeConte, 1850 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anthophylax

At a glance

Occurrence records77

Data sources7

Biological traits0

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Anthophylax viridis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anthophylax viridis is the species of the Lepturinae subfamily in long-horned beetle family.BioLib Taxon profile — species Anthophylax viridis LeConte, 1850 This beetle is distributed in Canada, and United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophylax viridis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

34Tmostly conserved

214Cvariable

316Avariable

361Tvariable

391Tmostly conserved

433Gmostly conserved

466Amostly conserved

484Cvariable

AACTTTATATTTTATTTTTGGTGCATGAGCAAGTATAGTTGGAACATCACTTAGAATACTAATTCGATCCGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes3

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neanthophylax mirificussame family10.5%Sachalinobia rugipennissame family10.9%Sachalinobia koltzeisame family11.5%Rhagium mordaxsame family11.9%Monochamus titillatorsame family12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor66

Museum / vouchered11

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 32≤1 km 15≤10 km 8>10 km 1

56 georeferenced · 10 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2≤10 km 1

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint John, CA	5
Toronto, CA	2
SOVTlocation not on record	2
Wuzhou, CN	1
AHABlocation not on record	1

5 institutions · 11 of 11 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Anthophylax viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 14.1–17.9

Seasonal swing summer↔winter25.8 °C

Max temp (day)21.4 °C 18.7–22.7

Min temp (night)12.7 °C 10.0–14.8

Precipitation117 mm/mo 99.5–128

Air humidity61.9 % 58.3–65.4

Moisture balance-13.3 mm/mo -42.6–8.30

Vapour deficit702 Pa 608–812

Wind speed2.70 m/s 2.10–4.20

Cloud cover50.0 % 44.3–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)