Anthophora walshii

Cresson, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records874

Data sources7

Biological traits0

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Anthophora walshii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility874 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF874 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anthophora walshii is a species of anthophorine bee in the family Apidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora walshii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

34Tvariable

103Cmostly conserved

271Tmostly conserved

415Gmostly conserved

631Tvariable

TATAATTTATTTTGTCTTTGCGTTATGATCAGGTATAGTTGGGACTTCTTTAAGGATAATTATTCGGATAGAGTTAAGGGTTCCGGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora montanasame genus9.6%Anthophora arequipensissame genus12.6%Anthophora leucophaeasame genus12.9%Anthophora senescenssame genus13.4%Anthophora femoratasame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type874 records

Wild obs. + sensor145

Museum / vouchered729

Range

Area of Occupancy AOO1 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 82≤1 km 24≤10 km 9>10 km 9

124 georeferenced · 21 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 381≤1 km 23≤10 km 64>10 km 7

475 georeferenced · 254 without coordinates

Open the institutions mapphysical evidence729

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	389
Wuzhou, CN	101
US	47
Royal Saskatchewan Museumlocation not on record	36
	30
Champaign, US	30
Cambridge, US	26
WIlocation not on record	23
St. Paul, US	16
WSUClocation not on record	9
Beltsville, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
University of Alabamalocation not on record	4
Chicago, US	3
OSUClocation not on record	2
UNHClocation not on record	2
Colorado State Universitylocation not on record	1
North Carolina State University Insect Museumlocation not on record	1
University of Nebraska State Museumlocation not on record	1

19 institutions · 729 of 729 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Anthophora walshii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 14.6–22.1

Seasonal swing summer↔winter28.6 °C

Max temp (day)25.5 °C 22.1–29.1

Min temp (night)12.9 °C 10.0–17.0

Precipitation33.7 mm/mo 31.5–60.6

Air humidity52.4 % 52.0–55.9

Moisture balance-107 mm/mo -122–-70.4

Vapour deficit995 Pa 795–1,257

Wind speed3.90 m/s 3.80–4.30

Cloud cover32.4 % 28.9–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)