Anthophora montana

Cresson, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records2 859

Data sources7

Biological traits1

DNA specimens12

eDNA detections12

Sources7 archives

Databases and archives Anthophora montana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 859 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 859 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anthophora montana is a species of anthophorine bee in the family Apidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.59 mm

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora montana has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

624Gmostly conserved

625Amostly conserved

628Amostly conserved

TATAATTTATTTTATTTTTGCTTTATGATCCGGTATAATTGGAACTTCTATAAGTATAATTATTCGAATAGAATTAAGAGTGCCAGGAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora walshiisame genus9.6%Anthophora dufouriisame genus10.2%Anthophora vannigerasame genus10.3%Anthophora quadrimaculatasame genus10.8%Anthophora mucidasame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 859 records

Wild obs. + sensor117

Museum / vouchered2 736

Other6

Range

Area of Occupancy AOO2 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 65≤1 km 20≤10 km 6>10 km 3

94 georeferenced · 23 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 983≤1 km 161≤10 km 107>10 km 73

1 324 georeferenced · 1 412 without coordinates

Open the institutions mapphysical evidence2 736

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	946
Colorado State Universitylocation not on record	525
	346
Beltsville, US	224
Wuzhou, CN	219
Awka, NG	179
Albuquerque, US	107
ASUlocation not on record	56
University of Alabamalocation not on record	33
Cambridge, US	19
WIlocation not on record	15
OSUClocation not on record	15
San Nicolás de los Garza, MX	9
Lubbock, US	9
Champaign, US	8
Mexico City, MX	6
US	4
Budapest, HU	3
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	3
US	3
EL PASO, US	2
Provo, US	1
ECOSUR-SClocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Chicago, US	1

25 institutions · 2 735 of 2 736 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Anthophora montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 5.70–18.0

Seasonal swing summer↔winter20.9 °C

Max temp (day)22.8 °C 12.1–25.2

Min temp (night)9.90 °C -0.2–12.1

Precipitation72.9 mm/mo 45.6–119

Air humidity49.7 % 46.6–53.6

Moisture balance-74.6 mm/mo -81.8–-30.7

Vapour deficit907 Pa 608–996

Wind speed2.50 m/s 2.10–2.80

Cloud cover20.8 % 17.3–32.2

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora montana

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 859 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 859 records