Anthophora crassipes

Lepeletier, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records279

Data sources6

Biological traits0

DNA specimens11

eDNA detections0

Sources6 archives

Databases and archives Anthophora crassipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility279 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF279 records

DNA & barcodingBOLD11 specimens

01Narrative

Anthophora crassipes ist eine Biene aus der Familie der Apidae. Die Weibchen können mit Anthophora quadrimaculata und Anthophora crinipes verwechselt werden.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora crassipes has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

19Amostly conserved

20Amostly conserved

26Tmostly conserved

35Tmostly conserved

37Amostly conserved

43Cmostly conserved

46Tmostly conserved

52Amostly conserved

53Amostly conserved

55Amostly conserved

58Cmostly conserved

64Amostly conserved

70Amostly conserved

77Amostly conserved

78Cmostly conserved

79Amostly conserved

86Amostly conserved

87Tmostly conserved

88Amostly conserved

95Amostly conserved

96Amostly conserved

107Cmostly conserved

109Amostly conserved

116Tmostly conserved

118Amostly conserved

124Tmostly conserved

127Amostly conserved

157Amostly conserved

166Cmostly conserved

178Amostly conserved

184Cmostly conserved

197Amostly conserved

199Tmostly conserved

202Amostly conserved

203Cmostly conserved

214Amostly conserved

215Gmostly conserved

217Amostly conserved

229Tmostly conserved

232Cmostly conserved

238Amostly conserved

253Gmostly conserved

271Tmostly conserved

274Cmostly conserved

279Cmostly conserved

284Tmostly conserved

287Tmostly conserved

289Amostly conserved

295Amostly conserved

314Cmostly conserved

316Tmostly conserved

319Amostly conserved

332Gmostly conserved

334Amostly conserved

337Cmostly conserved

340Amostly conserved

346Amostly conserved

349Tmostly conserved

352Amostly conserved

356Cmostly conserved

370Tmostly conserved

376Tmostly conserved

379Amostly conserved

386Amostly conserved

387Cmostly conserved

388Amostly conserved

391Cmostly conserved

415Amostly conserved

421Tmostly conserved

433Amostly conserved

475Amostly conserved

505Cmostly conserved

511Amostly conserved

514Tmostly conserved

526Amostly conserved

529Cmostly conserved

532Amostly conserved

539Cmostly conserved

541Cmostly conserved

544Tmostly conserved

550Amostly conserved

559Amostly conserved

562Amostly conserved

601Amostly conserved

604Cmostly conserved

625Tmostly conserved

628Tmostly conserved

649Cmostly conserved

AATTTATTTTATTTTTGCAATATGATCAGGAATATTAGGAACCTCTATAAGAATAATCATTCGAATAGAATTAAGAACACCTGGAATATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes3

BINs2

Most divergent pair13.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora bomboidessame genus10.7%Anthophora abruptasame genus10.9%Anthophora occidentalissame genus11.3%Anthophora quadrimaculatasame genus11.5%Anthophora plagiatasame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type279 records

Wild obs. + sensor75

Museum / vouchered170

Other34

Origin

Native93

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 19≤1 km 11≤10 km 27>10 km 3

60 georeferenced · 15 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 20≤10 km 141>10 km 3

164 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Coimbra, PT	28
Bern, CH	21
Zürich, CH	19
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
Musee d'Histoire Naturallelocation not on record	8
Paro, BT	6
Museum zu Allerheiligen Schaffhausenlocation not on record	4
UGRlocation not on record	2
Wuzhou, CN	2
Winterthur, CH	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
Beltsville, US	1
Bonn, DE	1
NMOKlocation not on record	1

14 institutions · 107 of 170 vouchered records shown · 63 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)