Anthonomus quesnelensis

Sleeper, 1955 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records74

Data sources4

Biological traits0

DNA specimens32

eDNA detections28

Sources4 archives

Databases and archives Anthonomus quesnelensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 1 countries28 detections

DNA & barcodingBOLD32 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus quesnelensis has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes2

eDNA detections28

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

1Avariable

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Gmostly conserved

23Gmostly conserved

24Tmostly conserved

25Cmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

36Cmostly conserved

37Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Cmostly conserved

44Amostly conserved

48Cmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

56Amostly conserved

58Amostly conserved

59Cmostly conserved

61Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Cmostly conserved

65Cmostly conserved

66Gmostly conserved

67Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Cmostly conserved

79Tmostly conserved

169Amostly conserved

202Amostly conserved

235Cmostly conserved

265Cmostly conserved

308Gmostly conserved

310Tmostly conserved

312Gvariable

319Amostly conserved

340Cmostly conserved

370Amostly conserved

400Cmostly conserved

403Tmostly conserved

421Cmostly conserved

433Gmostly conserved

438Cvariable

455Gmostly conserved

473Amostly conserved

485Cmostly conserved

565Amostly conserved

625Amostly conserved

628Cmostly conserved

631Gvariable

AACTTTATACTTTATTTTTGGGGTCTGATCAGGAACAGTTGGCACTTCTTTAAGAATACTTATCCGGACAGAACTAGGTAACCCCGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes3

BINs2

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthonomus humeralissame genus16.7%Anthonomus pomorumsame genus16.9%Anthonomus chevrolatisame genus16.9%Anthonomus signatussame genus17.2%Dorytomus squamosussame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type74 records

Museum / vouchered74

Range

Area of Occupancy AOO60 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 74 records without

Open the institutions mapphysical evidence74

10Collections & institutions

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	62
OSUClocation not on record	11

2 institutions · 73 of 74 vouchered records shown · 1 without an institution code

09Environmental DNA28 detections

Where the DNA of Anthonomus quesnelensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial | 14.5 Urban Ar…GrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.8–16.4

Seasonal swing summer↔winter23.2 °C

Max temp (day)18.8 °C 18.8–21.7

Min temp (night)7.40 °C 7.40–10.8

Precipitation145 mm/mo 74.9–145

Air humidity55.3 % 54.1–55.3

Moisture balance3.30 mm/mo -52.3–3.30

Vapour deficit663 Pa 663–869

Wind speed2.70 m/s 2.50–2.70

Cloud cover38.9 % 35.4–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)