Anthonomus signatus

Say & T., 1831 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records299

Data sources8

Biological traits0

DNA specimens67

eDNA detections67

Sources8 archives

Databases and archives Anthonomus signatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI67 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF299 records

Environmental DNA1 datasets · 2 countries67 detections

DNA & barcodingBOLD67 specimens

Genome at a glanceGoaT · TreeOfSex2n = 28

01Narrative

Anthonomus signatus, the strawberry bud weevil, is a weevil that is a significant pest of strawberries in North America. It is also thought to be a major pest to raspberries. It is native to North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus signatus has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes1

eDNA detections67

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus60 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

1Cmostly conserved

2Cmostly conserved

27Cmostly conserved

28Tmostly conserved

29Gmostly conserved

31Amostly conserved

35Gmostly conserved

40Avariable

58Cmostly conserved

64Amostly conserved

70Gmostly conserved

76Tvariable

82Amostly conserved

100Cvariable

103Tvariable

124Avariable

130Avariable

136Cvariable

193Avariable

211Tmostly conserved

235Cmostly conserved

259Gvariable

260Cmostly conserved

265Avariable

268Cvariable

291Tvariable

301Tmostly conserved

310Amostly conserved

313Tmostly conserved

325Gmostly conserved

343Gvariable

364Cvariable

370Amostly conserved

400Cvariable

415Cvariable

547Avariable

562Gvariable

625Gvariable

CCTATATTTTATTTTTGGTGCTTGATCTGGAACCGTCGGAACCTCCCTCAGAATACTCATTCGAACAGAGTTAGGTAACCCAGGAAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes12

BINs2

Most divergent pair3.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthonomus humeralissame genus14.4%Anthonomus robustulussame genus14.4%Anthonomus pomorumsame genus14.7%Anthonomus spilotussame genus14.7%Anthonomus rubidussame genus15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anthonomus signatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy2× diploid · measured

Chromosome records28–342n range31median28mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 344×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type299 records

Wild obs. + sensor125

Museum / vouchered174

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 55≤1 km 31≤10 km 4>10 km 11

101 georeferenced · 24 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 2≤10 km 36>10 km 10

48 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	44
OSUClocation not on record	26
Lexington, US	13
University of Alabamalocation not on record	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Espace pour la vielocation not on record	8
Lubbock, US	8
Albany, US	7
Saint John, CA	6
University of Guelphlocation not on record	5
Royal Saskatchewan Museumlocation not on record	5
UDlocation not on record	4
University of Central Floridalocation not on record	4
DPIlocation not on record	2
CUlocation not on record	1
Cambridge, US	1
Lake Placid, US	1
Colorado State Universitylocation not on record	1
PUC-RSlocation not on record	1
St. Paul, US	1
Centre for Biodiversity Genomicslocation not on record	1
SOVTlocation not on record	1

22 institutions · 162 of 174 vouchered records shown · 12 without an institution code

09Environmental DNA67 detections

Where the DNA of Anthonomus signatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found67

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 67 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandTemperate mixed forestFragaria ananassa1. Forest & Woodland | 1.1. Boreal ForestForest5. Wetlands (inland) | 5.4. Bogs, Marshes, S…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 12.3–18.0

Seasonal swing summer↔winter29.9 °C

Max temp (day)17.4 °C 16.6–22.6

Min temp (night)9.60 °C 8.10–14.4

Precipitation112 mm/mo 88.2–175

Air humidity56.9 % 56.9–63.3

Moisture balance-2.20 mm/mo -54.2–80.9

Vapour deficit674 Pa 561–811

Wind speed2.70 m/s 1.10–4.10

Cloud cover41.8 % 41.2–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 66 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)