Anthonomus pomorum

(C.Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records1 737

Data sources6

Biological traits0

DNA specimens26

eDNA detections3

Sources6 archives

Databases and archives Anthonomus pomorum's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 737 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 737 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD26 specimens

01Narrative

Anthonomus pomorum or the apple blossom weevil is a univoltine herbivore of apple trees, Malus domestica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus pomorum has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes3

eDNA detections3

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

23Gvariable

35Amostly conserved

43Avariable

163Avariable

187Cvariable

379Gmostly conserved

421Avariable

469Gmostly conserved

475Amostly conserved

490Avariable

616Cvariable

634Cvariable

643Gmostly conserved

646Tmostly conserved

649Avariable

AACTTTATATTTTATTTTTGGTGCCTGATCTGGAACCGTTGGAACTTCACTAAGAATACTAATTCGGACTGAATTAGGAAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes8

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthonomus rufussame genus10.2%Anthonomus chevrolatisame genus11.6%Anthonomus spilotussame genus12.1%Anthonomus foliicolasame genus12.2%Bradybatus fallaxsame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_044712 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 737 records

Wild obs. + sensor1 174

Museum / vouchered549

Fossil6

Other8

Range

Area of Occupancy AOO4 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 564≤1 km 232≤10 km 145>10 km 17

958 georeferenced · 216 without coordinates

Open the mapobservation + sensor1 174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 59≤1 km 144≤10 km 173>10 km 12

388 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence549

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	120
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	50
Provincia di Livornolocation not on record	29
Tartu, EE	28
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	25
MNHWlocation not on record	22
Philadelphia, US	16
Muzeum Górnośląskie w Bytomiulocation not on record	16
Salzburg, AT	15
Uniwersytet Wrocławskilocation not on record	15
Natural History Museum Rotterdamlocation not on record	10
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	10
Helsinki, FI	9
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	9
MZLUlocation not on record	7
NMOKlocation not on record	5
ZSMlocation not on record	4
NTNU-VMlocation not on record	4
Olocation not on record	4
Ugentlocation not on record	4
NHMOlocation not on record	3
Tilburg, NL	3
CBDClocation not on record	3
South Kensington, GB	2
OSUClocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
IFR-DNFlocation not on record	1
Chiba, JP	1
LSMlocation not on record	1
NCMGlocation not on record	1
Trondheim, NO	1

31 institutions · 420 of 549 vouchered records shown · 129 without an institution code

09Environmental DNA3 detections

Where the DNA of Anthonomus pomorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthonomus pomorum

At a glance

Sources6 archives

At a glance

Record type1 737 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 737 records