Anthocoris simulans

Reuter, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Anthocoridae/Anthocoris

At a glance

Occurrence records238

Data sources5

Biological traits2

DNA specimens9

eDNA detections0

Sources5 archives

Databases and archives Anthocoris simulans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility238 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF238 records

DNA & barcodingBOLD9 specimens

01Narrative

Anthocoris simulans is een wants uit de familie van de bloemwantsen (Anthocoridae). De soort werd het eerst wetenschappelijk beschreven door Odo Reuter in 1884.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocoris simulans has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

49Amostly conserved

74Cvariable

85Gvariable

184Gmostly conserved

304Gmostly conserved

469Avariable

AACTTTATATTTTATATTCGGAATATGAGCAGGAATACTAGGAACATCATTAAGATGAATCATTCGAATTGAGCTAGGACAACCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocoris minkisame genus2.6%Anthocoris confusussame genus11.6%Anthocoris gallarumulmisame genus11.7%Anthocoris butlerisame genus12.5%Anthocoris amplicollissame genus13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type238 records

Wild obs. + sensor180

Museum / vouchered46

Other12

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 61≤1 km 48≤10 km 47

156 georeferenced · 24 without coordinates

Open the mapobservation + sensor180

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 30≤1 km 7≤10 km 4

41 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	11
Norwegian Institute of Bioeconomy Researchlocation not on record	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
UO-CeStuBiolocation not on record	1
Jyväskylä, FI	1

5 institutions · 20 of 46 vouchered records shown · 26 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)