Anthocoris gallarumulmi

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Anthocoridae/Anthocoris

At a glance

Occurrence records644

Data sources7

Biological traits2

DNA specimens10

eDNA detections24

Sources7 archives

Databases and archives Anthocoris gallarumulmi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility644 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF644 records

Environmental DNA4 datasets · 6 countries24 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anthocoris gallarumulmi is a true bug in the family Anthocoridae. The species is a West Palearctic species found on aphid-galled leaves of Ulmus minor and is a predator of the aphid Eriosoma ulmi N. J. B. Parker, 1984 Biology and bionomics in Scotland of Anthocoris gallarum-ulmi Ecological Entomology Volume 9, Issue 1, pages 55–67, February 1984 [1] It is also associated with aphid-leaf galls of Fraxinus excelsior, Ribes, Prunus spinosa and Crataegus monogyna.Péricart, J. 1996. Family Anthocoridae Fieber, 1836 flower bugs, minute pirate bugs, pp. 108–318. In Aukema, B. and C. Rieger, eds. Catalogue of the Heteroptera of the Palaearctic Region. Vol. 2. Cimicomorpha I. Netherlands Entomological Society, Amsterdam. 359 pp.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocoris gallarumulmi has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections24

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

562Gmostly conserved

AACTTTATATTTTATATTCGGAATATGAGCAGGAATATTAGGAACATCATTAAGATGAATTATTCGAATCGAATTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocoris butlerisame genus9.9%Anthocoris confusussame genus9.9%Anthocoris antevolenssame genus11.2%Anthocoris amplicollissame genus11.2%Anthocoris minkisame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type644 records

Wild obs. + sensor417

Museum / vouchered204

Other23

Range

Area of Occupancy AOO1 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 203≤1 km 100≤10 km 49>10 km 3

355 georeferenced · 62 without coordinates

Open the mapobservation + sensor417

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 93≤1 km 73≤10 km 8

174 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence204

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	43
SLU Artdatabankenlocation not on record	19
Philadelphia, US	18
Forssa, FI	9
Bonn, DE	7
Jyväskylä, FI	4
ZMAAlocation not on record	3
Tartu, EE	2
neflocation not on record	2
Helsinki, FI	1

10 institutions · 108 of 204 vouchered records shown · 96 without an institution code

09Environmental DNA24 detections

Where the DNA of Anthocoris gallarumulmi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys4

Countries6

Verifiable raw sequence linked15

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map6 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.6–17.1

Seasonal swing summer↔winter19.8 °C

Max temp (day)19.1 °C 15.7–21.2

Min temp (night)10.7 °C 8.50–13.5

Precipitation71.1 mm/mo 55.5–94.9

Air humidity59.3 % 58.0–62.1

Moisture balance-39.7 mm/mo -45.5–8.00

Vapour deficit704 Pa 573–798

Wind speed2.50 m/s 2.20–3.30

Cloud cover48.5 % 37.0–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)