Anthocoris nemoralis

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Anthocoridae/Anthocoris

At a glance

Occurrence records5 153

Data sources9

Biological traits2

DNA specimens36

eDNA detections254

Sources9 archives

Databases and archives Anthocoris nemoralis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI254 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 153 records

Environmental DNA4 datasets · 9 countries254 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈301 Mbp

01Narrative

Anthocoris nemoralis is a true bug in the family Anthocoridae. The species is native to Europe and is introduced in North America.Fauna Europaea It is a predator of aphids, spider mites and jumping plant lice, and is therefore used as a biological pest control agent.Neil Helyer, Nigel D. Cattlin, Kevin C. Brown, 2014 Biological Control in Plant Protection: A Colour Handbook, Second Edition CRC Press

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocoris nemoralis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs3

Marker genes1

eDNA detections254

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 97 variable positions, in barcode order

7Gmostly conserved

19Cmostly conserved

49Amostly conserved

50Tmostly conserved

52Amostly conserved

61Cmostly conserved

70Cmostly conserved

74Cmostly conserved

83Cmostly conserved

112Cmostly conserved

127Tmostly conserved

133Tmostly conserved

157Cmostly conserved

163Tmostly conserved

169Tmostly conserved

172Tmostly conserved

187Cmostly conserved

197Cmostly conserved

202Gmostly conserved

214Tmostly conserved

223Amostly conserved

238Tmostly conserved

247Tmostly conserved

259Cmostly conserved

263Tmostly conserved

271Tmostly conserved

274Cmostly conserved

277Tmostly conserved

280Cmostly conserved

283Tmostly conserved

298Amostly conserved

301Tmostly conserved

307Tmostly conserved

316Tmostly conserved

322Amostly conserved

337Amostly conserved

340Tmostly conserved

346Cmostly conserved

347Tmostly conserved

352Tmostly conserved

355Amostly conserved

358Cmostly conserved

364Amostly conserved

367Cmostly conserved

379Tmostly conserved

382Amostly conserved

386Cmostly conserved

397Cmostly conserved

401Cmostly conserved

403Tmostly conserved

406Cmostly conserved

412Gmostly conserved

415Gmostly conserved

421Gmostly conserved

424Amostly conserved

433Amostly conserved

439Cmostly conserved

445Cmostly conserved

454Tmostly conserved

460Amostly conserved

463Tmostly conserved

469Gmostly conserved

472Tmostly conserved

478Gmostly conserved

483Cmostly conserved

499Tmostly conserved

511Amostly conserved

514Tmostly conserved

520Tmostly conserved

523Tmostly conserved

526Cmostly conserved

529Tmostly conserved

530Cmostly conserved

533Cmostly conserved

539Tmostly conserved

542Cmostly conserved

544Amostly conserved

548Cmostly conserved

553Amostly conserved

557Tmostly conserved

562Tmostly conserved

578Cmostly conserved

580Tmostly conserved

592Amostly conserved

595Cmostly conserved

598Cmostly conserved

601Tmostly conserved

610Tmostly conserved

619Amostly conserved

620Tmostly conserved

622Amostly conserved

625Tmostly conserved

628Gmostly conserved

631Gmostly conserved

637Tmostly conserved

646Cmostly conserved

658Tmostly conserved

AACTTTGTATTTTATATTCGGAATATGAGCAGGAATATTAGGAACATCATTAAGATGAATCATTCGAATCGAACTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes4

BINs3

Most divergent pair19.3%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocoris amplicollissame genus1.5%Anthocoris butlerisame genus5.5%Anthocoris confusussame genus10.7%Anthocoris gallarumulmisame genus11.9%Anthocoris minkisame genus12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthocoris nemoralis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈301 188 006 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthocoris nemoralis0.30 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98% BUSCO

08Occurrence & distribution

Record type5 153 records

Wild obs. + sensor4 684

Museum / vouchered401

Cultivated / captive1

Fossil2

Other65

Origin

Native42

Range

Area of Occupancy AOO11 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 1 786≤1 km 884≤10 km 1 710>10 km 7

4 387 georeferenced · 297 without coordinates

Open the mapobservation + sensor4 684

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 163≤1 km 123≤10 km 54

340 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence401

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	55
UAclocation not on record	41
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	41
SLU Artdatabankenlocation not on record	35
CBDClocation not on record	31
NCMGlocation not on record	28
Tartu, EE	8
neflocation not on record	7
ZSMlocation not on record	7
Bonn, DE	6
ZMAAlocation not on record	5
BioFokuslocation not on record	5
Philadelphia, US	4
Ugentlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Norwegian Institute of Bioeconomy Researchlocation not on record	3
MZLUlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
Winterthur, CH	2
South Kensington, GB	2
WGSlocation not on record	2
Vancouver, CA	1
DFlocation not on record	1
Jyväskylä, FI	1
UO-CeStuBiolocation not on record	1
Barcelona, ES	1
Provincia di Livornolocation not on record	1

27 institutions · 299 of 401 vouchered records shown · 102 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA254 detections

Where the DNA of Anthocoris nemoralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found254

Studies independent surveys4

Countries9

Verifiable raw sequence linked69

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 254 detections have coordinates

Open the map9 countries0

UrbanPelouses rases et lit majeur assec1. Forest & Woodland|1.4. Temperate ForestNon coniferous evergreen forestsUrban areaMixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 7.10–15.7

Seasonal swing summer↔winter16.0 °C

Max temp (day)17.6 °C 10.2–19.1

Min temp (night)10.6 °C 3.40–13.0

Precipitation65.6 mm/mo 44.5–89.6

Air humidity60.7 % 58.8–63.1

Moisture balance-53.0 mm/mo -68.7–6.30

Vapour deficit643 Pa 376–704

Wind speed4.10 m/s 2.60–5.00

Cloud cover44.5 % 38.9–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 251 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthocoris nemoralis

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 153 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 153 records