Anthidium maculosum

Cresson, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records1 789

Data sources7

Biological traits1

DNA specimens13

eDNA detections14

Sources7 archives

Databases and archives Anthidium maculosum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 789 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 789 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anthidium maculosum is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references It is a solitary bee where the males are territorial and the females take part in polyandry.Ferreira, Amilton, et al. "Comparative anatomy of the male reproductive internal organs of 51 species of bees." Neotropical Entomology 33.5 (2004): 569-576. The males of A. maculosum differ from most other males of bee species because the males are significantly larger than females. In addition, subordinate males that act as satellites are smaller than territory-owning males.Frohlich, Donald R., and Frank D. Parker. "Observations on the nest-building and reproductive behavior of a resin-gathering bee: Dianthidium ulkei (Hymenoptera: Megachilidae)." Annals of the Entomological Society of America 78.6 (1985): 804-810. This species can be found predominately in Mexico and the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.23 mm

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium maculosum has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 83 variable positions, in barcode order

4Tmostly conserved

16Tmostly conserved

19Tmostly conserved

23Tmostly conserved

29Tmostly conserved

31Gmostly conserved

40Cmostly conserved

43Tmostly conserved

45Cmostly conserved

46Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Amostly conserved

67Gmostly conserved

79Tmostly conserved

81Tmostly conserved

85Amostly conserved

88Amostly conserved

103Cmostly conserved

121Amostly conserved

124Amostly conserved

127Gmostly conserved

133Tmostly conserved

139Tmostly conserved

162Tmostly conserved

163Gmostly conserved

169Tmostly conserved

178Tmostly conserved

181Gmostly conserved

200Amostly conserved

202Tmostly conserved

217Amostly conserved

223Gmostly conserved

232Cmostly conserved

235Tmostly conserved

238Tmostly conserved

250Tmostly conserved

251Amostly conserved

253Tmostly conserved

265Gvariable

266Tmostly conserved

271Amostly conserved

274Tmostly conserved

290Tmostly conserved

293Tmostly conserved

294Tmostly conserved

307Tmostly conserved

309Gmostly conserved

310Amostly conserved

325Amostly conserved

328Tmostly conserved

343Tmostly conserved

352Tmostly conserved

359Amostly conserved

360Cmostly conserved

368Gmostly conserved

370Tmostly conserved

373Tmostly conserved

379Amostly conserved

382Tmostly conserved

421Cmostly conserved

433Gvariable

451Tmostly conserved

454Tmostly conserved

459Amostly conserved

466Amostly conserved

474Amostly conserved

478Amostly conserved

491Amostly conserved

508Amostly conserved

517Tmostly conserved

518Amostly conserved

539Tmostly conserved

553Tmostly conserved

562Amostly conserved

578Tmostly conserved

589Tmostly conserved

601Tmostly conserved

616Tmostly conserved

628Gmostly conserved

631Amostly conserved

634Tmostly conserved

646Tmostly conserved

AATTTTATATATAATTTTTGCTTTATGATCGGGAATAATCGGTTCTTCAATAAGAATAATTATTCGGATAGAATTAAGTATTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes6

BINs2

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium palmarumsame genus8.5%Anthidium penaisame genus9.0%Anthidium funereumsame genus9.0%Anthidium espinosaisame genus9.4%Anthidium utahensesame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 789 records

Wild obs. + sensor501

Museum / vouchered1 258

Other30

Range

Area of Occupancy AOO2 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 231≤1 km 170≤10 km 16>10 km 35

452 georeferenced · 49 without coordinates

Open the mapobservation + sensor501

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 45≤1 km 25≤10 km 227>10 km 68

365 georeferenced · 893 without coordinates

Open the institutions mapphysical evidence1 258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	320
Wuzhou, CN	232
University of Alabamalocation not on record	217
University of California, Davislocation not on record	116
Champaign, US	84
San Diego, US	71
ASUlocation not on record	47
Cambridge, US	34
Beltsville, US	27
Mexico City, MX	27
Ciudad de México, MX	20
Awka, NG	10
Santa Barbara Museum of Natural Historylocation not on record	9
Colorado State Universitylocation not on record	8
Universidad de las Américas, Pueblalocation not on record	7
Santa Cruz, US	6
La Jolla, US	5
Provo, US	5
Lubbock, US	1
Albuquerque, US	1
US	1
College Station, US	1
University of Arizona, Insect Collectionlocation not on record	1
ECOSUR-SClocation not on record	1
WSUClocation not on record	1
WIlocation not on record	1
US	1
San Nicolás de los Garza, MX	1
Tapachula, MX	1
University of Central Floridalocation not on record	1
UFPRlocation not on record	1

31 institutions · 1 258 of 1 258 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Anthidium maculosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 14.5–25.1

Seasonal swing summer↔winter17.9 °C

Max temp (day)25.7 °C 20.7–32.3

Min temp (night)12.4 °C 8.60–18.8

Precipitation15.5 mm/mo 6.70–92.7

Air humidity46.3 % 37.7–54.6

Moisture balance-107 mm/mo -183–-75.5

Vapour deficit1,067 Pa 808–1,764

Wind speed2.20 m/s 1.60–3.20

Cloud cover18.2 % 13.8–26.9

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthidium maculosum

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 789 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 789 records