Anthidium loti

Perris, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records427

Data sources7

Biological traits0

DNA specimens26

eDNA detections52

Sources7 archives

Databases and archives Anthidium loti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF427 records

Environmental DNA1 datasets · 9 countries52 detections

DNA & barcodingBOLD26 specimens

01Narrative

Anthidium loti is a Palearctic species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.2004, Apoidea Database, Fauna EuropaeaCatalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium loti has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes2

eDNA detections52

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

79Cmostly conserved

85Cmostly conserved

142Amostly conserved

184Tmostly conserved

187Amostly conserved

232Tmostly conserved

241Tmostly conserved

256Tmostly conserved

268Tmostly conserved

271Tmostly conserved

274Amostly conserved

424Gmostly conserved

448Tmostly conserved

463Cmostly conserved

475Amostly conserved

505Amostly conserved

589Tmostly conserved

ATCTTCAATAAGAATAATTATTCGAATAGAATTAAGAATTCCTGGTTCATGAATTGAAAATGATCAAATTTATAATTCCTTAGTCACAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BINs2

Most divergent pair2.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium palmarumsame genus8.3%Anthidium penaisame genus8.3%Anthidium manicatumsame genus8.4%Anthidium placitumsame genus8.6%Anthidium funereumsame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PLWRHO

animal barcodemarker

08Occurrence & distribution

Record type427 records

Wild obs. + sensor212

Museum / vouchered165

Other50

Origin

Native41

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 84≤1 km 28≤10 km 36>10 km 5

153 georeferenced · 59 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 9≤1 km 32≤10 km 66>10 km 2

109 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Coimbra, PT	37
Wuzhou, CN	29
Zürich, CH	29
Beltsville, US	15
Muzeum Górnośląskie w Bytomiulocation not on record	13
ZSMlocation not on record	5
UGRlocation not on record	5
Cambridge, US	4
	4
Geneva, CH	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
USALlocation not on record	1

14 institutions · 149 of 165 vouchered records shown · 16 without an institution code

09Environmental DNA52 detections

Where the DNA of Anthidium loti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 10.4–24.1

Seasonal swing summer↔winter18.1 °C

Max temp (day)18.5 °C 14.3–28.2

Min temp (night)12.1 °C 5.50–18.2

Precipitation68.3 mm/mo 31.8–126

Air humidity55.8 % 52.5–59.5

Moisture balance-50.2 mm/mo

Vapour deficit777 Pa 615–1,380

Wind speed2.90 m/s

Cloud cover40.7 % 28.2–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)