Anthicus hastatus

Casey, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthicidae/Anthicus

At a glance

Occurrence records36

Data sources7

Biological traits0

DNA specimens12

eDNA detections9

Sources7 archives

Databases and archives Anthicus hastatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF36 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anthicus hastatus is a species of antlike flower beetle in the family Anthicidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthicus hastatus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)4.2%

Haplotypes1

BIN1

Where individuals differ — all 69 variable positions, in barcode order

1Gvariable

2Avariable

3Cvariable

4Tvariable

5Cvariable

6Tvariable

7Avariable

9Avariable

10Cvariable

11Tmostly conserved

13Amostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

23Gmostly conserved

24Cmostly conserved

25Amostly conserved

26Tmostly conserved

27Gmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Gmostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Tmostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

82Cmostly conserved

83Cmostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

212Cmostly conserved

232Gmostly conserved

352Cmostly conserved

448Tmostly conserved

516Tmostly conserved

602Amostly conserved

GACTCTATACTTAATTTTTGGAGCATGAGCAGGAATAGTAGGAACTTCGCTTAGATTACTAATTCGATCAGAATTAGGAAACCCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthicus antherinussame genus10.8%Stricticollis longicollissame family12.5%Anthicus flavipessame genus12.6%Anthicus punctulatussame genus13.4%Anthicus cervinussame genus13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type36 records

Wild obs. + sensor3

Museum / vouchered33

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 20>10 km 2

22 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
EWIClocation not on record	3
Royal Saskatchewan Museumlocation not on record	3
Lubbock, US	2
Washington, US	2
University of Central Floridalocation not on record	1

7 institutions · 32 of 33 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Anthicus hastatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 10.9–26.0

Seasonal swing summer↔winter23.0 °C

Max temp (day)24.8 °C 17.3–32.4

Min temp (night)11.7 °C 6.80–20.8

Precipitation63.1 mm/mo 41.9–145

Air humidity53.2 % 48.5–55.9

Moisture balance-70.3 mm/mo -147–3.30

Vapour deficit1,155 Pa 577–1,653

Wind speed3.40 m/s 2.10–4.50

Cloud cover31.3 % 21.5–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)