Anthicus punctulatus

LeConte, 1851 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthicidae/Anthicus

At a glance

Occurrence records196

Data sources6

Biological traits0

DNA specimens42

eDNA detections38

Sources6 archives

Databases and archives Anthicus punctulatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility196 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF196 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD42 specimens

01Narrative

Anthicus punctulatus is a species of antlike flower beetle in the family Anthicidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthicus punctulatus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs1

Marker genes1

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

52Amostly conserved

184Gmostly conserved

202Tmostly conserved

235Cmostly conserved

271Amostly conserved

343Amostly conserved

460Cmostly conserved

508Cmostly conserved

542Cvariable

548Cmostly conserved

550Amostly conserved

596Tmostly conserved

622Gvariable

634Tmostly conserved

646Tmostly conserved

CACTTTATATTTAATTTTTGGAGCATGAGCAGGAATAGTAGGAACATCACTAAGACTTCTTATTCGATCAGAATTAGGAAATCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes18

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthicus cervinussame genus10.4%Malporus formicariussame family11.8%Cyclodinus conicepssame family12.0%Anthicus antherinussame genus12.3%Endomia tenuicollissame family12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type196 records

Wild obs. + sensor5

Museum / vouchered191

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2>10 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1>10 km 2

4 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	114
University of Central Floridalocation not on record	72
San Francisco, US	2
Cambridge, US	1
Royal Saskatchewan Museumlocation not on record	1
US	1

6 institutions · 191 of 191 vouchered records shown

09Environmental DNA38 detections

Where the DNA of Anthicus punctulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Forest - Temperate

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 12.1–29.7

Seasonal swing summer↔winter20.3 °C

Max temp (day)25.2 °C 17.1–36.6

Min temp (night)9.50 °C 5.70–21.7

Precipitation25.7 mm/mo 0.7–48.2

Air humidity45.9 % 41.7–58.2

Moisture balance-138 mm/mo -194–1.20

Vapour deficit1,098 Pa 579–2,425

Wind speed2.80 m/s 1.20–3.50

Cloud cover17.9 % 11.6–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)