Anthicus cervinus

LaFerté-Senéctère, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthicidae/Anthicus

At a glance

Occurrence records518

Data sources8

Biological traits0

DNA specimens183

eDNA detections182

Sources8 archives

Databases and archives Anthicus cervinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility518 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI182 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics183 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF518 records

Environmental DNA1 datasets · 2 countries182 detections

DNA & barcodingBOLD183 specimens

01Narrative

Anthicus cervinus, the cloudy flower beetle, is a species of antlike flower beetle in the family Anthicidae. It is found in Central America and North America. Cloudy flower beetle, Anthicus cervinus

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding183 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthicus cervinus has left across the world's sequence archives.

At a glance

DNA specimens183

BINs1

Marker genes2

eDNA detections182

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus173 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

10Tmostly conserved

166Gmostly conserved

316Avariable

322Avariable

337Avariable

340Cvariable

415Gvariable

428Tvariable

500Cmostly conserved

520Tvariable

542Tvariable

578Cmostly conserved

613Tvariable

628Gvariable

TACTTTATATTTAATTTTTGGAGCATGGGCAGGAATAGTAGGAACATCACTAAGACTTCTAATTCGATCTGAACTAGGAAATCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes27

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthicus punctulatussame genus10.4%Sapintus pusillussame family11.8%Stricticollis longicollissame family12.2%Cyclodinus conicepssame family12.3%Cordicomus gracilissame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type518 records

Wild obs. + sensor81

Museum / vouchered437

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 41≤1 km 21≤10 km 1>10 km 8

71 georeferenced · 10 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 1≤1 km 13≤10 km 39>10 km 24

77 georeferenced · 360 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	86
University Park, US	46
University of Guelphlocation not on record	42
Santa Barbara Museum of Natural Historylocation not on record	33
Royal Saskatchewan Museumlocation not on record	23
College Station, US	22
Lubbock, US	17
Cambridge, US	14
Lexington, US	6
OSUClocation not on record	3
University of Nebraska State Museumlocation not on record	3
Edmonton, CA	2
University of Central Floridalocation not on record	2
CUlocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
US	1
EWIClocation not on record	1

18 institutions · 304 of 437 vouchered records shown · 133 without an institution code

09Environmental DNA182 detections

Where the DNA of Anthicus cervinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found182

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 182 detections have coordinates

Open the map2 countries0

Agriculturalfarm14. Artificial - Terrestrial|14.1 Arable LandTemperate mixed forestRiparian ZoneSandy beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 6.20–18.8

Seasonal swing summer↔winter26.3 °C

Max temp (day)12.4 °C 10.7–22.9

Min temp (night)3.10 °C 1.70–17.5

Precipitation80.7 mm/mo 71.9–96.5

Air humidity55.9 % 55.1–60.1

Moisture balance-13.5 mm/mo -54.1–-1.10

Vapour deficit450 Pa 420–897

Wind speed4.40 m/s 2.80–5.00

Cloud cover46.5 % 39.4–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 178 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)