Anthicus ephippium

Laferte, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthicidae/Anthicus

At a glance

Occurrence records95

Data sources6

Biological traits0

DNA specimens5

eDNA detections3

Sources6 archives

Databases and archives Anthicus ephippium's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anthicus ephippium is a species of antlike flower beetle in the family Anthicidae. It is found in Central America, North America, and Oceania.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthicus ephippium has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

79Gvariable

85Cvariable

TACATTATATTTAATTTTTGGAGCATGAGCAGGAATAGTAGGTACATCTCTAAGATTACTAATTCGATCTGAATTAGGGAATCCCGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthicus scabricepssame genus9.6%Anthicus cervinussame genus12.3%Anthicus coracinussame genus12.8%Anthicus sellatussame genus13.2%Anthicus atersame genus13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor11

Museum / vouchered84

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 5≤1 km 2>10 km 1

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 1≤1 km 4≤10 km 10>10 km 1

16 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	49
University Park, US	13
Santa Barbara Museum of Natural Historylocation not on record	12
University of Guelphlocation not on record	3
CUlocation not on record	2
Cambridge, US	1
University of Central Floridalocation not on record	1
Champaign, US	1
EWIClocation not on record	1
University of Nebraska State Museumlocation not on record	1

10 institutions · 84 of 84 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Anthicus ephippium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 11.4–25.8

Seasonal swing summer↔winter28.8 °C

Max temp (day)24.6 °C 17.8–31.4

Min temp (night)13.3 °C 5.50–21.1

Precipitation78.4 mm/mo 69.2–87.6

Air humidity56.6 % 54.5–58.6

Moisture balance-60.8 mm/mo -80.7–-40.8

Vapour deficit1,033 Pa 652–1,414

Wind speed2.30 m/s 2.20–2.50

Cloud cover42.6 % 31.9–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)