Anthicus coracinus

LeConte, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthicidae/Anthicus

At a glance

Occurrence records49

Data sources6

Biological traits0

DNA specimens7

eDNA detections5

Sources6 archives

Databases and archives Anthicus coracinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anthicus coracinus is een keversoort uit de familie snoerhalskevers (Anthicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1851 door LeConte.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthicus coracinus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

157Tmostly conserved

184Amostly conserved

202Cmostly conserved

205Amostly conserved

278Cmostly conserved

334Tmostly conserved

343Tmostly conserved

362Gmostly conserved

544Tmostly conserved

595Cmostly conserved

628Avariable

646Tmostly conserved

AACGTTATATTTAATTTTTGGAGCATGAGCAGGAATAGTAGGTACATCTCTAAGATTACTAATTCGATCTGAATTAGGAAATCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes3

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthicus atersame genus2.6%Malporus formicariussame family11.4%Anthicus sellatussame genus12.5%Stricticollis longicollissame family12.7%Anthicus punctulatussame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type49 records

Museum / vouchered49

Range

Area of Occupancy AOO88 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 14≤1 km 10≤10 km 2

26 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence49

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	26
Royal Saskatchewan Museumlocation not on record	13
University of Alberta Museums (UAM)location not on record	7
University of Guelphlocation not on record	2

4 institutions · 48 of 49 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Anthicus coracinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

lakeshore, grass, birch, poplar, bird vetchon grass/branchesMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 3.80–16.6

Seasonal swing summer↔winter34.2 °C

Max temp (day)16.1 °C 9.20–21.8

Min temp (night)3.90 °C -1.10–12.4

Precipitation55.7 mm/mo 52.6–94.4

Air humidity56.0 % 54.5–57.8

Moisture balance-16.2 mm/mo -48.3–12.2

Vapour deficit556 Pa 356–830

Wind speed2.50 m/s 1.70–2.90

Cloud cover57.9 % 44.6–63.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)