Antheraea montezuma

Sallé, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Antheraea

At a glance

Occurrence records33

Data sources6

Biological traits0

DNA specimens8

eDNA detections3

Sources6 archives

Databases and archives Antheraea montezuma's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD8 specimens

01Narrative

Antheraea montezuma is een vlinder uit de familie van de nachtpauwogen (Saturniidae). De wetenschappelijke naam van de soort is, als Saturnia montezuma, voor het eerst geldig gepubliceerd in 1856 door Sallé.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antheraea montezuma has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

25Tvariable

106Tvariable

160Amostly conserved

184Tmostly conserved

205Tmostly conserved

263Cmostly conserved

265Amostly conserved

292Tmostly conserved

334Cmostly conserved

352Tmostly conserved

382Cmostly conserved

403Amostly conserved

428Cmostly conserved

508Avariable

541Tmostly conserved

556Amostly conserved

586Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGTACTTCTTTAAGACTTTTAATTCGAGCAGAATTAGGAACCCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes5

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antheraea polyphemussame genus5.0%Antheraea godmanisame genus5.5%Antheraea pahangensissame genus8.1%Antheraea castaneasame genus8.1%Antheraea frithisame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor10

Museum / vouchered17

Other6

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 2≤10 km 3

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 17

17 georeferenced

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	12
Ciudad de México, MX	4
Facultad de Ciencias Biológicas y Agropecuarias, Universidad de Colimalocation not on record	1

3 institutions · 17 of 17 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Antheraea montezuma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)