Antheraea godmani

Druce, 1892 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Antheraea

At a glance

Occurrence records165

Data sources7

Biological traits0

DNA specimens25

eDNA detections24

Sources7 archives

Databases and archives Antheraea godmani's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility165 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF165 records

Environmental DNA1 datasets · 5 countries24 detections

DNA & barcodingBOLD25 specimens

01Narrative

Antheraea godmani is a moth of the family Saturniidae first described by Herbert Druce in 1892. It is found from Mexico to Colombia."Antheraea godmani". Kirby Wolfe Saturniidae Collection. Retrieved December 22, 2019.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antheraea godmani has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections24

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

133Cvariable

148Amostly conserved

160Avariable

202Tvariable

226Tmostly conserved

379Tvariable

412Avariable

433Avariable

601Tmostly conserved

616Cvariable

619Cvariable

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACTTCTTTAAGACTTTTAATTCGAGCAGAATTAGGAACCCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.95%

Haplotypes6

BIN1

Most divergent pair1.8%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antheraea montezumasame genus5.5%Antheraea polyphemussame genus5.9%Antheraea hagedornisame genus6.7%Antheraea lampeisame genus7.0%Antheraea pahangensissame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type165 records

Wild obs. + sensor73

Museum / vouchered70

Other22

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 39≤1 km 14≤10 km 1>10 km 2

56 georeferenced · 17 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 39≤10 km 12

51 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	44
National Biodiversity Institute, Costa Ricalocation not on record	18
New Haven, US	4
Ciudad de México, MX	2
University of Pennsylvanialocation not on record	1
Denver, US	1

6 institutions · 70 of 70 vouchered records shown

09Environmental DNA24 detections

Where the DNA of Antheraea godmani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 16.2–25.7

Seasonal swing summer↔winter2.10 °C

Max temp (day)25.6 °C 21.0–30.6

Min temp (night)18.2 °C 11.9–21.0

Precipitation225 mm/mo 110–398

Air humidity66.5 % 59.1–71.1

Moisture balance96.6 mm/mo -52.6–241

Vapour deficit829 Pa 598–1,326

Wind speed1.20 m/s 0.7–2.10

Cloud cover19.5 % 17.4–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)