Antheraea frithi

Moore, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Antheraea

At a glance

Occurrence records68

Data sources6

Biological traits0

DNA specimens73

eDNA detections39

Sources6 archives

Databases and archives Antheraea frithi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 5 countries39 detections

DNA & barcodingBOLD73 specimens

01Narrative

Antheraea frithi est une espèce de grands lépidoptères nocturnes dont la taille peut atteindre une envergure de 10 à 15 cm. Elle se rencontre dans les hautes montagnes en Chine, dans la péninsule indochinoise et une partie de l'Indonésie, ainsi que dans le nord de l'Inde. Ce papillon se caractérise par un grand ocelle sur chacune des ailes qui a pour but d'effrayer les prédateurs. Le mâle se distingue par ses antennes plumeuses et sa couleur rouge brique. Sa première paire d'ailes possède un bord incurvé d'une manière fort originale. Le corps de cette espèce est important avec une tête minuscule. L'adulte n'a pas de système digestif fonctionnel, car il vit peu de temps et uniquement sur des réserves accumulées par la chenille. Celle-ci est verte, épaisse et charnue. Elle se nourrit de feuilles d'arbres, surtout du genre Shorea. Elle forme sa chrysalide dans une enveloppe de soie.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antheraea frithi has left across the world's sequence archives.

At a glance

DNA specimens73

BINs5

Marker genes1

eDNA detections39

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 58 variable positions, in barcode order

5Cvariable

85Tmostly conserved

133Tmostly conserved

142Tmostly conserved

190Avariable

202Avariable

205Amostly conserved

206Cvariable

208Avariable

212Tmostly conserved

220Tvariable

223Avariable

235Cmostly conserved

238Cvariable

250Tmostly conserved

253Avariable

271Tvariable

274Tmostly conserved

278Tmostly conserved

280Amostly conserved

283Tvariable

307Amostly conserved

319Tmostly conserved

322Amostly conserved

328Amostly conserved

340Tvariable

349Tmostly conserved

352Avariable

355Amostly conserved

364Cmostly conserved

367Tmostly conserved

382Tmostly conserved

400Cvariable

401Cvariable

403Tvariable

412Avariable

415Tmostly conserved

451Tvariable

472Amostly conserved

478Tvariable

484Tmostly conserved

500Tvariable

502Amostly conserved

529Cmostly conserved

532Tmostly conserved

536Tvariable

547Tmostly conserved

562Tmostly conserved

589Tvariable

607Tmostly conserved

616Cvariable

619Tmostly conserved

622Tmostly conserved

628Amostly conserved

637Tmostly conserved

640Tmostly conserved

646Cvariable

658Tmostly conserved

AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTCTAATTCGAGCAGAATTAGGAACCCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes21

BINs5

Most divergent pair9.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antheraea harndtisame genus2.7%Antheraea luteofrithisame genus3.2%Antheraea paphiasame genus4.3%Antheraea gschwandnerisame genus4.7%Antheraea sumbaensissame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027071 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type68 records

Wild obs. + sensor43

Museum / vouchered25

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 16≤1 km 14≤10 km 5>10 km 3

38 georeferenced · 5 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 12>10 km 9

21 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	8
Natural History Museum of Utahlocation not on record	5
New Haven, US	5
Auckland, NZ	2
Research Collection of Eric Van Schaycklocation not on record	2
Zürich, CH	1
Research Collection of Ulrich & Laela H. Paukstadtlocation not on record	1

7 institutions · 24 of 25 vouchered records shown · 1 without an institution code

09Environmental DNA39 detections

Where the DNA of Antheraea frithi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 16.4–28.5

Seasonal swing summer↔winter11.0 °C

Max temp (day)26.3 °C 19.8–30.7

Min temp (night)18.6 °C 12.3–23.7

Precipitation115 mm/mo 34.1–286

Air humidity64.7 % 61.8–70.0

Moisture balance-4.80 mm/mo -76.6–164

Vapour deficit901 Pa 718–1,273

Wind speed2.10 m/s 1.30–3.30

Cloud cover69.5 % 43.7–75.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)