Anthene larydas

(Cramer, 1782) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Anthene

At a glance

Occurrence records1 464

Data sources8

Biological traits0

DNA specimens13

eDNA detections16

Sources8 archives

Databases and archives Anthene larydas's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 464 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 464 records

Environmental DNA1 datasets · 7 countries16 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anthene larydas, the spotted hairtail or common ciliate blue, is a butterfly in the family Lycaenidae. It is found in Senegal, the Gambia, Guinea-Bissau, Guinea, Burkina Faso, Liberia, Sierra Leone, Ivory Coast, Ghana, Nigeria, Cameroon, the Republic of the Congo, the Central African Republic, the Democratic Republic of the Congo, Uganda and western Kenya. The habitat consists of forests and Guinea savanna. Adult males mud-puddle and are also attracted to sand soaked by urine as well as by human sweat. The larvae feed on Acacia farnesiana, Afzelia species, Albizia gummifera, Albizia zygia, Dichrostachys glomerata and Hypericum species. They are associated with the ant species Pheidole aurivillii race kasaiensis, Camponotus akwapimensis var. poultoni and Crematogaster striatula var. horati.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthene larydas has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections16

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

16Cmostly conserved

43Cmostly conserved

45Amostly conserved

78Tmostly conserved

93Tmostly conserved

96Tmostly conserved

150Tmostly conserved

162Tmostly conserved

180Amostly conserved

198Tmostly conserved

201Tmostly conserved

213Cmostly conserved

216Cmostly conserved

228Tmostly conserved

249Cmostly conserved

342Tmostly conserved

375Tmostly conserved

378Amostly conserved

457Amostly conserved

477Cmostly conserved

478Cmostly conserved

517Cmostly conserved

531Amostly conserved

543Amostly conserved

567Cmostly conserved

594Tmostly conserved

603Amostly conserved

ATTTGAGCAGGTATACTAGGAACATCTTTAAGTATTTTAATTCGAATAGAATTAGGAACACCAAGATCATTAATTGGTGATGATCAAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes4

BINs2

Most divergent pair0.80%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthene liguressame genus6.4%Actizera lucidasame family6.6%Anthene schoutedenisame genus6.9%Ocaria ocrisiasame family7.0%Anthene definitasame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 464 records

Wild obs. + sensor1 069

Museum / vouchered395

Range

Area of Occupancy AOO1 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 331≤1 km 214≤10 km 96>10 km 17

658 georeferenced · 411 without coordinates

Open the mapobservation + sensor1 069

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤1 km 2≤10 km 36>10 km 42

81 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence395

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
African Butterfly Research Institutelocation not on record	149
Cleveland Museum of Natural History, OH (CLEV)location not on record	78
New Haven, US	58
Durban Natural Science Museumlocation not on record	44
Uniwersytet Jagiellońskilocation not on record	31
Cambridge, US	20
MZLUlocation not on record	4
Helsinki, FI	3
Tartu, EE	1
Cape Town, ZA	1
Zürich, CH	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

12 institutions · 391 of 395 vouchered records shown · 4 without an institution code

09Environmental DNA16 detections

Where the DNA of Anthene larydas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 20.8–25.4

Seasonal swing summer↔winter2.10 °C

Max temp (day)29.1 °C 25.7–31.7

Min temp (night)19.4 °C 15.8–21.1

Precipitation116 mm/mo 45.5–205

Air humidity61.1 % 55.4–69.1

Moisture balance-23.4 mm/mo -104–69.3

Vapour deficit1,085 Pa 867–1,452

Wind speed1.30 m/s 1.00–2.40

Cloud cover36.0 % 22.6–55.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthene larydas

At a glance

Sources8 archives

At a glance

Record type1 464 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 464 records