Anthene ligures

(Hewitson, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Anthene

At a glance

Occurrence records71

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Anthene ligures's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility71 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF71 records

DNA & barcodingBOLD5 specimens

01Narrative

Anthene ligures, the lesser indigo ciliate blue, is a butterfly in the family Lycaenidae. It is found in Ghana, Togo, Nigeria (south and the Cross River loop), Cameroon, Gabon, the Republic of the Congo, Angola, the Democratic Republic of the Congo, Uganda, western and central Kenya, Tanzania, Malawi and Zambia. The habitat consists of forests. Adult males are attracted to damp patches. The larvae feed on Celtis species. The larvae are green with a darker green dorsal line, flanked on either side with yellow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthene ligures has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

92Tmostly conserved

100Amostly conserved

181Amostly conserved

202Amostly conserved

205Tmostly conserved

214Amostly conserved

220Gvariable

223Amostly conserved

238Tmostly conserved

284Tmostly conserved

292Tmostly conserved

343Cmostly conserved

382Tmostly conserved

385Tmostly conserved

397Cmostly conserved

412Amostly conserved

415Tmostly conserved

466Gvariable

470Amostly conserved

484Cmostly conserved

536Tmostly conserved

548Tmostly conserved

557Tmostly conserved

574Tmostly conserved

586Tmostly conserved

595Tmostly conserved

616Cmostly conserved

619Tmostly conserved

625Amostly conserved

634Cmostly conserved

637Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGAACATCATTAAGTATTTTAATTCGAATAGAATTAGGAATACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes5

BINs2

Most divergent pair4.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthene schoutedenisame genus3.5%Anthene indefinitasame genus4.1%Anthene definitasame genus4.6%Satyrium w-albumsame family5.5%Superflua sassanidessame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type71 records

Wild obs. + sensor29

Museum / vouchered42

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 5≤1 km 7≤10 km 6>10 km 1

19 georeferenced · 10 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9>10 km 21

30 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	20
Uniwersytet Jagiellońskilocation not on record	12
Cambridge, US	10

3 institutions · 42 of 42 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)