Ocaria ocrisia

(Hewitson, 1868) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Ocaria

At a glance

Occurrence records1 421

Data sources7

Biological traits0

DNA specimens8

eDNA detections7

Sources7 archives

Databases and archives Ocaria ocrisia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 421 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Ocaria ocrisia, the black hairstreak or Hewitson's blackstreak, is a butterfly of the family Lycaenidae. It was described by William Chapman Hewitson in 1868. It is found from Mexico to Brazil, Paraguay, Peru, Ecuador and Argentina.Ocaria at funet It has also been recorded from southern Arizona.mothphotographersgroup The habitat consists of rainforests at altitudes ranging from 200 to 900 meters.Butterflies of the Amazon and Andes The wingspan is about 27 mm.sangay.eu

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ocaria ocrisia has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

25Tmostly conserved

82Amostly conserved

118Tmostly conserved

160Amostly conserved

169Amostly conserved

235Cmostly conserved

280Amostly conserved

290Amostly conserved

292Tvariable

307Amostly conserved

358Cmostly conserved

364Cmostly conserved

376Tmostly conserved

385Tmostly conserved

428Cmostly conserved

441Amostly conserved

499Cvariable

529Avariable

562Amostly conserved

565Amostly conserved

581Tmostly conserved

616Cmostly conserved

622Gmostly conserved

623Gmostly conserved

634Tmostly conserved

646Tvariable

652Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACATCTTTAAGAATTTTAATTCGAATAGAATTAGGAACACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes3

BINs2

Most divergent pair1.4%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arawacus lincoidessame family4.9%Cyanophrys longuloidessame family5.0%Laothus barajosame family5.0%Ministrymon phrutussame family5.2%Cyanophrys argentinensissame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 421 records

Wild obs. + sensor272

Museum / vouchered1 039

Other110

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 96≤1 km 85≤10 km 39>10 km 10

230 georeferenced · 42 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 119≤1 km 50≤10 km 17>10 km 5

191 georeferenced · 848 without coordinates

Open the institutions mapphysical evidence1 039

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad de México, MX	506
Ciudad de México, MX	202
Mexico City, MX	185
Uniwersytet Jagiellońskilocation not on record	47
Universidad del Valle (UniValle)location not on record	36
Cambridge, US	10
Tapachula, MX	9
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	9
Washington, US	7
New Haven, US	6
Ciudad de México, MX	6
The University of the West Indies, Trinidad and Tobagolocation not on record	4
National Biodiversity Institute, Costa Ricalocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Chongqing Museumlocation not on record	1

15 institutions · 1 031 of 1 039 vouchered records shown · 8 without an institution code

09Environmental DNA7 detections

Where the DNA of Ocaria ocrisia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 19.6–26.7

Seasonal swing summer↔winter10.1 °C

Max temp (day)25.1 °C 23.6–28.8

Min temp (night)16.3 °C 14.2–24.8

Precipitation140 mm/mo 99.1–194

Air humidity63.4 % 63.1–63.5

Moisture balance15.3 mm/mo -46.4–43.4

Vapour deficit905 Pa 833–1,282

Wind speed1.70 m/s 1.70–3.60

Cloud cover47.7 % 29.1–63.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ocaria ocrisia

At a glance

Sources7 archives

At a glance

Record type1 421 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 421 records