Anthene emolus

(Godart, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Anthene

At a glance

Occurrence records1 868

Data sources7

Biological traits0

DNA specimens23

eDNA detections22

Sources7 archives

Databases and archives Anthene emolus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 868 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 868 records

Environmental DNA1 datasets · 3 countries22 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anthene emolus, the ciliate blue, is a small butterfly found in India and southeast Asia that belongs to the lycaenids or blues family. The species was first described by Jean-Baptiste Godart in 1823.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthene emolus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections22

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

4Cmostly conserved

46Cmostly conserved

67Amostly conserved

79Amostly conserved

115Cmostly conserved

133Tmostly conserved

283Amostly conserved

364Avariable

379Tmostly conserved

577Amostly conserved

581Cmostly conserved

628Amostly conserved

634Tmostly conserved

646Tmostly conserved

AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACCTCATTAAGTATTTTAATTCGAATAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes5

BIN1

Most divergent pair1.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthene paraffinissame genus5.2%Theorema eumeniasame family6.2%Arawacus lincoidessame family6.4%Anthene liguressame genus6.5%Paraspiculatus emmasame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 868 records

Wild obs. + sensor1 828

Museum / vouchered40

Range

Area of Occupancy AOO2 648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 396≤1 km 820≤10 km 189>10 km 82

1 487 georeferenced · 341 without coordinates

Open the mapobservation + sensor1 828

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 2≤10 km 13>10 km 9

24 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	12
Natural History Museum, Tribhuvan Universitylocation not on record	10
Cambridge, US	8
University of Malaya, Museum of Zoologylocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Vietnam National Museum of Naturelocation not on record	1
Toronto, CA	1
Auckland, NZ	1

8 institutions · 37 of 40 vouchered records shown · 3 without an institution code

09Environmental DNA22 detections

Where the DNA of Anthene emolus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map3 countries0

Park1. Forest & Woodland | 1.6. Subtropical/Trop…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 25.4–28.9

Seasonal swing summer↔winter5.00 °C

Max temp (day)31.1 °C 29.5–33.7

Min temp (night)22.6 °C 19.2–25.1

Precipitation182 mm/mo 80.6–344

Air humidity62.3 % 58.3–68.2

Moisture balance34.6 mm/mo -60.9–220

Vapour deficit1,416 Pa 1,076–1,504

Wind speed2.00 m/s 0.9–2.20

Cloud cover52.8 % 22.7–83.3

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthene emolus

At a glance

Sources7 archives

At a glance

Record type1 868 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 868 records