Anthaxia passerinii

(Pecchioli, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records132

Data sources7

Biological traits0

DNA specimens5

eDNA detections0

Sources7 archives

Databases and archives Anthaxia passerinii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility132 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF132 records

DNA & barcodingBOLD5 specimens

01Narrative

Anthaxia passerinii (häufig auch unkorrekt Anthaxia passerini geschrieben) ist ein Käfer aus der Familie der Prachtkäfer und der Unterfamilie Buprestinae. Die Gattung Anthaxia ist in Europa mit vier Untergattungen vertreten, Anthaxia passerinii wird zur Untergattung Anthaxia s. s. gerechnet, die in Europa mit 47 Arten vertreten ist. Die Arten der Anthaxia passerinii-Gruppe sind am nächsten mit den Arten der Anthaxia candens-Gruppe verwandt. Der Käfer kommt in Mitteleuropa nicht vor. Abb. 1: Aufsicht Abb. 2: Beschädigtes Exemplar, Unterseite Abb. 3: Halsschild Abb. 4: Flügeldecken

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia passerinii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.61%

Haplotypes2

BIN1

Most divergent pair1.2%

Where individuals differ — all 8 variable positions, in barcode order

271Cmostly conserved

352Cmostly conserved

412Tmostly conserved

466Gmostly conserved

478Tmostly conserved

496Amostly conserved

583Tmostly conserved

631Gmostly conserved

AACATTATACTTCATCTTTGGTGCCTGATCTGGTATAATCGGAACTGCCCTAAGACTTCTTATTCGCGCAGAATTAGGAAATCCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia olympicasame genus7.3%Anthaxia confusasame genus13.0%Anthaxia aeneogastersame genus14.9%Anthaxia helveticasame genus16.1%Anthaxia salicissame genus16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type132 records

Wild obs. + sensor81

Museum / vouchered51

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 40≤1 km 21≤10 km 4>10 km 8

73 georeferenced · 8 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤1 km 12≤10 km 1

13 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	22
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	14
MZLUlocation not on record	12
Helsinki, FI	1
Ilia State Universitylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

6 institutions · 51 of 51 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)