Anthaxia salicis

(Fabricius, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records2 906

Data sources8

Biological traits0

DNA specimens12

eDNA detections9

Sources8 archives

Databases and archives Anthaxia salicis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 906 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 906 records

Environmental DNA1 datasets · 6 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Der Weidenprachtkäfer oder Bunte Eichenprachtkäfer (Anthaxia salicis) ist ein Käfer aus der Familie der Prachtkäfer (Buprestidae). Mit fünf bis acht Millimeter Länge gehört er zu den kleinen bunten mitteleuropäischen Arten der Gattung Anthaxia. Anders als sein Name vermuten lässt, lebt der Käfer hauptsächlich an Eichen. Es gibt auch einen Großen Weidenprachtkäfer. Die Art ist wie die meisten Prachtkäfer gemäß der Bundesartenschutzverordnung gesetzlich besonders geschützt. In der Roten Liste gefährdeter Arten Deutschlands wird die Art unter der Kategorie 3 (gefährdet) geführt. In Sachsen-Anhalt gilt sie als vom Aussterben bedroht, in Schleswig-Holstein als ausgestorben oder verschollen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia salicis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections9

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Where individuals differ — all 147 variable positions, in barcode order

4Tmostly conserved

5Cmostly conserved

10Tmostly conserved

22Tmostly conserved

28Amostly conserved

40Amostly conserved

43Cmostly conserved

49Cmostly conserved

50Cvariable

52Gmostly conserved

58Tmostly conserved

59Cmostly conserved

79Tmostly conserved

82Cmostly conserved

94Tmostly conserved

103Cmostly conserved

115Cmostly conserved

139Tmostly conserved

142Tmostly conserved

151Tmostly conserved

154Cmostly conserved

157Cmostly conserved

163Gvariable

172Cmostly conserved

181Amostly conserved

187Cmostly conserved

196Amostly conserved

197Tmostly conserved

202Tmostly conserved

214Gmostly conserved

217Amostly conserved

235Tmostly conserved

241Amostly conserved

250Cmostly conserved

266Tmostly conserved

274Cvariable

277Amostly conserved

283Tmostly conserved

286Tmostly conserved

290Cmostly conserved

304Tmostly conserved

307Tmostly conserved

312Amostly conserved

322Cmostly conserved

325Tmostly conserved

328Tmostly conserved

331Amostly conserved

337Amostly conserved

340Cmostly conserved

343Amostly conserved

346Cmostly conserved

349Amostly conserved

379Tmostly conserved

385Cmostly conserved

386Tmostly conserved

400Amostly conserved

401Cmostly conserved

406Cmostly conserved

412Amostly conserved

415Amostly conserved

418Tmostly conserved

421Tmostly conserved

427Cmostly conserved

430Amostly conserved

439Tmostly conserved

442Tmostly conserved

445Cmostly conserved

454Amostly conserved

463Cmostly conserved

482Tmostly conserved

484Amostly conserved

490Tmostly conserved

493Amostly conserved

499Tmostly conserved

502Cmostly conserved

508Amostly conserved

514Amostly conserved

522Tmostly conserved

523Tmostly conserved

524Amostly conserved

525Cmostly conserved

526Amostly conserved

527Gmostly conserved

528Cmostly conserved

529Cvariable

530Gmostly conserved

531Tmostly conserved

532Tmostly conserved

533Cmostly conserved

534Tmostly conserved

536Cmostly conserved

537Tmostly conserved

538Cvariable

540Tmostly conserved

541Tmostly conserved

542Cmostly conserved

543Tmostly conserved

544Cmostly conserved

545Tmostly conserved

546Cmostly conserved

547Amostly conserved

548Cmostly conserved

549Tmostly conserved

550Cmostly conserved

553Amostly conserved

554Gmostly conserved

555Tmostly conserved

556Cmostly conserved

558Tmostly conserved

559Tmostly conserved

560Gmostly conserved

561Cmostly conserved

562Amostly conserved

563Gmostly conserved

565Amostly conserved

566Gmostly conserved

567Cmostly conserved

568Amostly conserved

570Tmostly conserved

571Tmostly conserved

+27 more variable positions not shown

AACTCTATATTTTATCTTCGGTGCATGATCCGGAATAGTAGGCACAGCCCTGAGACTTCTAATTCGTGCAGAATTAGGTAACCCCGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes5

BINs2

Most divergent pair13.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia semicupreasame genus10.8%Anthaxia helveticasame genus15.0%Anthaxia confusasame genus15.3%Anthaxia olympicasame genus15.3%Anthaxia mendizabalisame genus16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 906 records

Wild obs. + sensor1 903

Museum / vouchered913

Other90

Origin

Native576

Range

Area of Occupancy AOO4 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 405≤1 km 191≤10 km 878>10 km 19

1 493 georeferenced · 410 without coordinates

Open the mapobservation + sensor1 903

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 2≤1 km 65≤10 km 779>10 km 15

861 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence913

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	116
Geneva, CH	55
Paro, BT	51
Musee d'Histoire Naturallelocation not on record	47
Brussels, BE	46
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	41
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	38
Zürich, CH	37
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	27
Fribourg, CH	17
Natural History Museum Rotterdamlocation not on record	17
MZLUlocation not on record	15
Provincia di Livornolocation not on record	13
Frauenfeld, CH	12
Muzeum Górnośląskie w Bytomiulocation not on record	11
Museo civico Brancaleoni di Piobbicolocation not on record	6
RBINS-Scientific Heritagelocation not on record	5
Vitoria, ES	4
University of Sydney, Macleay Museumlocation not on record	2
NMOKlocation not on record	2
Tilburg, NL	1
Naturmuseum St. Gallenlocation not on record	1

22 institutions · 564 of 913 vouchered records shown · 349 without an institution code

09Environmental DNA9 detections

Where the DNA of Anthaxia salicis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map6 countries0

Dry acidic grasslands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 10.6–17.7

Seasonal swing summer↔winter17.6 °C

Max temp (day)17.4 °C 14.5–22.1

Min temp (night)7.90 °C 5.30–12.4

Precipitation45.1 mm/mo 37.3–78.4

Air humidity56.4 % 54.3–58.1

Moisture balance-49.7 mm/mo -116–-31.7

Vapour deficit658 Pa 555–918

Wind speed3.30 m/s 2.70–3.70

Cloud cover39.0 % 27.6–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthaxia salicis

At a glance

Sources8 archives

At a glance

Record type2 906 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 906 records