Anthaxia helvetica

Stierlin, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records7 633

Data sources8

Biological traits0

DNA specimens33

eDNA detections29

Sources8 archives

Databases and archives Anthaxia helvetica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 633 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 633 records

Environmental DNA1 datasets · 3 countries29 detections

DNA & barcodingBOLD33 specimens

01Narrative

Der Schweizer Prachtkäfer (Anthaxia helvetica) gehört zu einer Gruppe sehr ähnlich aussehender kleiner dunkler Prachtkäfer, die sich häufig auf gelben Blüten aufhalten und gelegentlich als „schwarze Arten“ der Gattung Anthaxia zusammengefasst werden. Die Art ist wie die meisten Prachtkäfer gemäß der Bundesartenschutzverordnung gesetzlich besonders geschützt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia helvetica has left across the world's sequence archives.

At a glance

DNA specimens33

BINs3

Marker genes1

eDNA detections29

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 64 variable positions, in barcode order

19Tmostly conserved

22Cmostly conserved

31Tmostly conserved

34Cmostly conserved

46Tmostly conserved

52Gmostly conserved

58Tmostly conserved

61Amostly conserved

74Tmostly conserved

82Tvariable

85Amostly conserved

103Tmostly conserved

112Tmostly conserved

118Cmostly conserved

142Tmostly conserved

157Tmostly conserved

187Cvariable

205Tmostly conserved

211Gmostly conserved

212Tmostly conserved

220Tmostly conserved

235Tmostly conserved

250Cmostly conserved

259Tmostly conserved

271Cmostly conserved

277Cmostly conserved

280Cmostly conserved

286Tmostly conserved

316Avariable

319Cmostly conserved

322Cmostly conserved

334Amostly conserved

337Avariable

340Cmostly conserved

343Cmostly conserved

352Amostly conserved

355Tmostly conserved

358Tmostly conserved

364Tvariable

373Avariable

376Tmostly conserved

379Tmostly conserved

400Cvariable

403Cmostly conserved

415Tmostly conserved

421Cmostly conserved

457Cmostly conserved

500Cmostly conserved

508Cmostly conserved

535Tmostly conserved

541Cmostly conserved

544Tvariable

547Cmostly conserved

550Cmostly conserved

553Tmostly conserved

556Amostly conserved

562Tmostly conserved

568Cmostly conserved

595Cmostly conserved

616Tvariable

619Amostly conserved

634Tmostly conserved

643Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGCGCCTGATCTGGCATAGTAGGAACTGCACTGAGACTTCTAATTCGTGCAGAATTAGGAAATCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes17

BINs3

Most divergent pair14.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia istrianasame genus7.3%Anthaxia inornatasame genus12.5%Anthaxia aeneogastersame genus12.6%Selagis peronisame family14.7%Merimna atratasame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 633 records

Wild obs. + sensor3 670

Museum / vouchered3 851

Other112

Origin

Native2 800

Range

Area of Occupancy AOO8 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 528≤1 km 239≤10 km 2 513>10 km 29

3 309 georeferenced · 361 without coordinates

Open the mapobservation + sensor3 670

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 111≤10 km 3 511>10 km 29

3 651 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence3 851

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee d'Histoire Naturallelocation not on record	650
Bern, CH	209
Geneva, CH	174
Fribourg, CH	161
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	158
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	126
Paro, BT	120
Muzeum Górnośląskie w Bytomiulocation not on record	94
Zürich, CH	86
Provincia di Livornolocation not on record	66
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	58
Dhaka, BD	58
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	50
Natural History Museum Rotterdamlocation not on record	28
Frauenfeld, CH	28
Museum zu Allerheiligen Schaffhausenlocation not on record	23
	20
ZSMlocation not on record	13
Salzburg, AT	12
IFR-DNFlocation not on record	11
IZNElocation not on record	10
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	10
Naturmuseum St. Gallenlocation not on record	9
Sion, CH	7
Uniwersytet Wrocławskilocation not on record	6
Winterthur, CH	6
Helsinki, FI	4
Naturmuseum Oltenlocation not on record	4
MfNBlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
South Kensington, GB	3
Museo civico Brancaleoni di Piobbicolocation not on record	2
INCONNUlocation not on record	2
NMOKlocation not on record	2
Philadelphia, US	1

35 institutions · 2 218 of 3 851 vouchered records shown · 1 633 without an institution code

09Environmental DNA29 detections

Where the DNA of Anthaxia helvetica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map3 countries0

Trockener MischwaldMoorgebiet

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 9.90–17.3

Seasonal swing summer↔winter18.8 °C

Max temp (day)18.2 °C 14.4–21.4

Min temp (night)9.30 °C 3.50–12.5

Precipitation87.6 mm/mo 67.1–193

Air humidity60.1 % 57.6–62.5

Moisture balance-22.2 mm/mo -47.5–69.8

Vapour deficit649 Pa 483–822

Wind speed3.00 m/s 1.90–3.60

Cloud cover36.5 % 31.7–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthaxia helvetica

At a glance

Sources8 archives

At a glance

Record type7 633 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 633 records