Anthaxia dimidiata

(Thunberg, 1789) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records430

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Anthaxia dimidiata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility430 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF430 records

DNA & barcodingBOLD5 specimens

01Narrative

Anthaxia dimidiata é uma espécie de insetos coleópteros polífagos pertencente à família Buprestidae. A autoridade científica da espécie é Thunberg, tendo sido descrita no ano de 1789. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia dimidiata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.86%

Haplotypes2

BINs2

Most divergent pair2.1%

Where individuals differ — all 14 variable positions, in barcode order

99Tmostly conserved

153Cmostly conserved

162Amostly conserved

202Cmostly conserved

207Amostly conserved

283Tmostly conserved

369Amostly conserved

370Gmostly conserved

414Tmostly conserved

462Gmostly conserved

546Amostly conserved

624Amostly conserved

636Tmostly conserved

651Amostly conserved

TTATATTTTTTTTTTGGCGCATGATCAGGAATAGTAGGAACAGCTCTTAGACTATTAATTCGAGCAGAACTTGGAAATCCAGGAACCTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia bicolorsame genus12.7%Anthaxia podolicasame genus14.7%Anthaxia cichoriisame genus14.9%Anthaxia fulguranssame genus15.5%Anthaxia signaticollissame genus17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type430 records

Wild obs. + sensor408

Museum / vouchered22

Range

Area of Occupancy AOO1 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 176≤1 km 66≤10 km 36>10 km 10

288 georeferenced · 120 without coordinates

Open the mapobservation + sensor408

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 4≤10 km 3

7 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	9
Paris, FR	5
Natural History Museum Rotterdamlocation not on record	2
Philadelphia, US	1
Vitoria, ES	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

6 institutions · 19 of 22 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)