Anthaxia fulgurans

(Schrank, 1789) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records2 887

Data sources8

Biological traits0

DNA specimens19

eDNA detections16

Sources8 archives

Databases and archives Anthaxia fulgurans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 887 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 887 records

Environmental DNA1 datasets · 4 countries16 detections

DNA & barcodingBOLD19 specimens

01Narrative

160px160px 180px180px Abb. 1: oben Weibchenunten Männchen Abb. 2: Seitenansicht (Männchen)Unterseite (Weibchen) zentriert|Abb. 3: Aedeagus Abb. 4: rechte Flügeldeckenspitze Abb. 5: Halsschild, rechte Hälfte Abb. 6: Kopf von schräg vorn Abb. 7: Ausschnitt Flügeldecke (Weibchen) im Schulterbereich(in der Ecke rechts oben Schildchen teilweise sichtbar) Der Fleckhals-Prachtkäfer (Anthaxia fulgurans) ist ein Käfer aus der Familie der Prachtkäfer. Die artenreiche Gattung Anthaxia ist in Europa mit vier Untergattungen vertreten. Der Fleckhals-Prachtkäfer wird zur Untergattung Anthaxia gerechnet, die in Europa mit 46 Arten vertreten ist. Wie fast alle Arten der Prachtkäfer ist auch der Fleckhals-Prachtkäfer durch die Bundesartenschutzverordnung besonders geschützt. Bundesweit gilt der Käfer als vom Aussterben bedroht. In Sachsen-Anhalt wird er als ausgestorben eingestuft.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia fulgurans has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 101 variable positions, in barcode order

4Amostly conserved

10Cmostly conserved

16Tmostly conserved

19Cmostly conserved

22Tmostly conserved

25Amostly conserved

46Cvariable

49Cmostly conserved

52Amostly conserved

55Amostly conserved

56Tmostly conserved

58Amostly conserved

62Gmostly conserved

67Gmostly conserved

70Cmostly conserved

79Tmostly conserved

82Tmostly conserved

91Amostly conserved

92Tmostly conserved

94Amostly conserved

103Tmostly conserved

127Tmostly conserved

136Tmostly conserved

139Tmostly conserved

145Cmostly conserved

184Amostly conserved

202Tmostly conserved

205Cmostly conserved

206Cmostly conserved

217Tmostly conserved

247Cmostly conserved

250Tmostly conserved

253Amostly conserved

262Amostly conserved

265Tmostly conserved

274Cmostly conserved

278Tmostly conserved

280Amostly conserved

286Amostly conserved

289Gvariable

290Cmostly conserved

312Gmostly conserved

313Amostly conserved

316Tmostly conserved

319Amostly conserved

322Amostly conserved

325Amostly conserved

343Amostly conserved

346Amostly conserved

358Cmostly conserved

376Cmostly conserved

380Gmostly conserved

400Amostly conserved

403Tmostly conserved

407Cmostly conserved

415Amostly conserved

421Amostly conserved

424Amostly conserved

427Tmostly conserved

439Tmostly conserved

442Cmostly conserved

448Cmostly conserved

460Cmostly conserved

469Amostly conserved

473Tmostly conserved

482Tmostly conserved

485Cmostly conserved

487Amostly conserved

496Amostly conserved

508Amostly conserved

517Amostly conserved

526Tmostly conserved

529Amostly conserved

532Tmostly conserved

533Cmostly conserved

535Cmostly conserved

541Tmostly conserved

542Cmostly conserved

544Tmostly conserved

547Cmostly conserved

548Cmostly conserved

553Amostly conserved

559Gmostly conserved

562Tmostly conserved

580Cmostly conserved

581Cmostly conserved

589Tmostly conserved

592Tmostly conserved

595Cmostly conserved

596Tmostly conserved

598Amostly conserved

619Tmostly conserved

628Amostly conserved

631Avariable

634Tmostly conserved

637Tmostly conserved

640Tmostly conserved

643Tmostly conserved

646Tmostly conserved

649Amostly conserved

652Tmostly conserved

AACATTATACTTTATTTTCGGTGCATGATCAGGAATAGTAGGAACCGCCCTAAGATTATTAGTTCGGGCCGAACTGGGTAATCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes5

BINs3

Most divergent pair15.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia bicolorsame genus13.2%Anthaxia podolicasame genus14.0%Anthaxia thalassophilasame genus14.1%Anthaxia olympicasame genus15.0%Anilara longicollissame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 887 records

Wild obs. + sensor2 225

Museum / vouchered598

Other64

Origin

Native81

Range

Area of Occupancy AOO5 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 609≤1 km 328≤10 km 646>10 km 23

1 606 georeferenced · 619 without coordinates

Open the mapobservation + sensor2 225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 22≤1 km 82≤10 km 275>10 km 7

386 georeferenced · 212 without coordinates

Open the institutions mapphysical evidence598

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	150
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	63
Natural History Museum Rotterdamlocation not on record	51
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	49
Paro, BT	42
Provincia di Livornolocation not on record	35
Bern, CH	21
Helsinki, FI	15
Fribourg, CH	14
MZLUlocation not on record	14
Radicondoli, IT	12
Zürich, CH	7
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Geneva, CH	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
MfNBlocation not on record	2
NTNU-VMlocation not on record	1
ZSMlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

19 institutions · 484 of 598 vouchered records shown · 114 without an institution code

09Environmental DNA16 detections

Where the DNA of Anthaxia fulgurans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 12.2–20.2

Seasonal swing summer↔winter20.7 °C

Max temp (day)21.4 °C 16.2–23.6

Min temp (night)11.9 °C 6.60–15.3

Precipitation76.2 mm/mo 53.5–199

Air humidity57.4 % 56.1–61.0

Moisture balance-47.0 mm/mo -63.6–63.1

Vapour deficit836 Pa 606–947

Wind speed3.70 m/s 2.70–4.10

Cloud cover37.1 % 35.4–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthaxia fulgurans

At a glance

Sources8 archives

At a glance

Record type2 887 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 887 records