Anthaxia podolica

Mannerheim, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records966

Data sources9

Biological traits0

DNA specimens15

eDNA detections14

Sources9 archives

Databases and archives Anthaxia podolica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility966 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF966 records

Environmental DNA1 datasets · 6 countries14 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT · TreeOfSex2n = 16

01Narrative

Anthaxia podolica é uma espécie de insetos coleópteros polífagos pertencente à família Buprestidae. A autoridade científica da espécie é Mannerheim, tendo sido descrita no ano de 1837. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia podolica has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections14

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

65Cmostly conserved

76Gmostly conserved

157Cmostly conserved

400Gmostly conserved

589Cmostly conserved

643Tmostly conserved

AACATTATACTTTATTTTTGGTGCATGATCAGGAATAGTAGGAACAGCTCTCAGCCTTTTAATTCGAGCAGAACTGGGAAACCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia bicolorsame genus11.2%Anthaxia fulguranssame genus14.0%Chrysobothris malisame family16.0%Temognatha herossame family16.9%Psathyromyia shannonisame order17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anthaxia podolica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Karagyan G, Kuznetsova KG (2000) Chromosome numbers and sex chromosome systems in buprestid beetles (Coleoptera, Buprestidae). Entomological Review 80: 38-49. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type966 records

Wild obs. + sensor662

Museum / vouchered287

Other17

Origin

Native67

Range

Area of Occupancy AOO2 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 218≤1 km 101≤10 km 105>10 km 14

438 georeferenced · 224 without coordinates

Open the mapobservation + sensor662

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 5≤1 km 31≤10 km 147>10 km 6

189 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence287

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	38
Muzeum Górnośląskie w Bytomiulocation not on record	34
Provincia di Livornolocation not on record	28
Helsinki, FI	21
Bern, CH	17
MZLUlocation not on record	12
Natural History Museum Rotterdamlocation not on record	12
NMOKlocation not on record	8
Musee d'Histoire Naturallelocation not on record	7
Geneva, CH	4
Radicondoli, IT	4
ZSMlocation not on record	3
Paro, BT	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
BioFokuslocation not on record	1
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

18 institutions · 196 of 287 vouchered records shown · 91 without an institution code

09Environmental DNA14 detections

Where the DNA of Anthaxia podolica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map6 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 6.30–18.9

Seasonal swing summer↔winter21.0 °C

Max temp (day)20.4 °C 9.80–23.9

Min temp (night)10.6 °C 1.10–12.6

Precipitation67.8 mm/mo 48.9–112

Air humidity57.9 % 56.3–61.8

Moisture balance-41.0 mm/mo -71.7–13.1

Vapour deficit786 Pa 384–980

Wind speed3.20 m/s 2.30–3.90

Cloud cover37.9 % 33.3–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)