Anthaxia candens

(Panzer, 1793) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records1 011

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Anthaxia candens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 011 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 011 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Bild 2: Seitenansicht Bild 3: Kopf Bild 4: Unterseite Der Kirschprachtkäfer oder Bunte Kirschbaumprachtkäfer (Anthaxia candens) ist ein Käfer aus der Familie der Prachtkäfer (Buprestidae). Mit sieben bis elf Millimeter Länge gehört er zu den größeren Arten der Gattung Anthaxia. Mit seinen smaragdgrünen, kupferroten und schwarzblauen Farben ist er der bunteste Prachtkäfer Mitteleuropas. Die Art ist wie die meisten Prachtkäfer gemäß der Bundesartenschutzverordnung gesetzlich besonders geschützt. In der Roten Liste gefährdeter Arten Deutschlands wird die Art unter der Kategorie 2 (stark gefährdet) geführt. In Rheinland-Pfalz und Nordrhein-Westfalen wird sie als gefährdet eingestuft (Kategorie 3). In Sachsen-Anhalt gilt sie als verschollen oder ausgestorben.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia candens has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTCGGCGCCTGATCTGGTATAGTAGGAACAGCTCTTAGACTATTAATCCGTGCAGAATTAGGAAATCCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia bicolorsame genus13.8%Anthaxia fulguranssame genus14.6%Anthaxia istrianasame genus14.7%Anthaxia mancasame genus15.0%Anthaxia quadripunctatasame genus15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 011 records

Wild obs. + sensor834

Museum / vouchered156

Other21

Origin

Native209

Range

Area of Occupancy AOO2 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 206≤1 km 59≤10 km 447>10 km 22

734 georeferenced · 100 without coordinates

Open the mapobservation + sensor834

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 2≤1 km 9≤10 km 89>10 km 7

107 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	33
Zürich, CH	12
Paro, BT	8
Provincia di Livornolocation not on record	7
ZSMlocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
Fribourg, CH	4
Geneva, CH	4
Musee d'Histoire Naturallelocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
Naturmuseum Solothurnlocation not on record	2
Bern, CH	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

14 institutions · 93 of 156 vouchered records shown · 63 without an institution code

09Environmental DNA9 detections

Where the DNA of Anthaxia candens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 8.60–19.1

Seasonal swing summer↔winter18.1 °C

Max temp (day)19.5 °C 12.3–23.5

Min temp (night)9.50 °C 4.80–14.7

Precipitation63.1 mm/mo 53.2–65.8

Air humidity58.1 % 56.8–63.4

Moisture balance-46.5 mm/mo -69.7–-3.90

Vapour deficit732 Pa 465–961

Wind speed3.40 m/s 2.20–3.70

Cloud cover34.5 % 32.3–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthaxia candens

At a glance

Sources8 archives

At a glance

Record type1 011 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 011 records