Anthaxia manca

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records841

Data sources8

Biological traits0

DNA specimens7

eDNA detections6

Sources8 archives

Databases and archives Anthaxia manca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility841 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF841 records

Environmental DNA1 datasets · 5 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Bild 1: Aufsicht Bild 2: Seitenansicht Bild 3: Kopf Bild 4: Unterseite Der Kleine Ulmenprachtkäfer (Anthaxia manca) ist ein Käfer aus der Familie der Prachtkäfer (Buprestidae). Mit sieben bis elf Millimeter Länge gehört er zu den größeren Arten der Gattung Anthaxia. Die Färbung erinnert an die größeren Männchen des Ungarischen Prachtkäfers (Anthaxia hungarica), bei denen jedoch im Unterschied zum Kleinen Ulmenprachtkäfer die Flügeldecken eingebuchtet sind, wodurch ein Teil des Hinterleibs von oben sichtbar wird. Die Art ist wie die meisten Prachtkäfer gemäß der Bundesartenschutzverordnung gesetzlich besonders geschützt. In der Roten Liste gefährdeter Arten Deutschlands und in Sachsen-Anhalt wird die Art unter der Kategorie 2 (stark gefährdet) geführt. In Schleswig-Holstein gilt sie als ausgestorben oder verschollen, in Brandenburg als vom Aussterben bedroht. In Rheinland-Pfalz wird sie als gefährdet eingestuft (Kategorie 3).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia manca has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

13Tmostly conserved

274Avariable

358Cmostly conserved

397Cvariable

496Amostly conserved

595Cmostly conserved

628Avariable

AACACTTTACTTTATTTTTGGAGCCTGATCTGGAATAGTCGGAACAGCCCTTAGATTATTAATTCGAGCAGAACTTGGTAATCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes3

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia candenssame genus15.0%Anthaxia fisherisame genus16.6%Stigmodera roeisame family17.0%Anthaxia scorzoneraesame genus17.3%Chrysochroa fulgidissimasame family17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type841 records

Wild obs. + sensor479

Museum / vouchered327

Other35

Origin

Native95

Range

Area of Occupancy AOO1 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 100≤1 km 50≤10 km 209>10 km 12

371 georeferenced · 108 without coordinates

Open the mapobservation + sensor479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 2≤1 km 25≤10 km 243>10 km 19

289 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence327

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	44
Bern, CH	40
Geneva, CH	22
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	21
Vitoria, ES	17
Fribourg, CH	17
Natural History Museum Rotterdamlocation not on record	16
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
Provincia di Livornolocation not on record	13
Paro, BT	10
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
Zürich, CH	7
Muzeum Górnośląskie w Bytomiulocation not on record	5
WIlocation not on record	5
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	3
Tilburg, NL	2
Uniwersytet Wrocławskilocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
NTNU-VMlocation not on record	2
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1
Paris, FR	1

22 institutions · 255 of 327 vouchered records shown · 72 without an institution code

09Environmental DNA6 detections

Where the DNA of Anthaxia manca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map5 countries0

Auszucht aus UlmenÃ¤stenprivate gardenSaulaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 12.2–18.7

Seasonal swing summer↔winter18.6 °C

Max temp (day)17.1 °C 16.5–22.3

Min temp (night)8.00 °C 6.90–13.7

Precipitation61.0 mm/mo 45.7–77.1

Air humidity57.6 % 55.8–60.1

Moisture balance-45.3 mm/mo

Vapour deficit619 Pa 587–941

Wind speed3.80 m/s

Cloud cover35.9 % 30.7–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)