Antaeotricha manzanitae

Keifer, 1937 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Antaeotricha

At a glance

Occurrence records23

Data sources7

Biological traits0

DNA specimens9

eDNA detections5

Sources7 archives

Databases and archives Antaeotricha manzanitae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD9 specimens

01Narrative

Antaeotricha manzanitae is a moth in the family Depressariidae. It was described by Hartford Hammond Keifer in 1937. It is found in North America, where it has been recorded from California, Oregon and British Columbia."Antaeotricha Zeller, 1854" at Markku Savela's Lepidoptera and Some Other Life Forms. The wingspan is 25–30 mm. The forewings are white, irregularly shaded with fuscous scales and with two patches of dark scales at the anal angle. The apical margin has a row of faint, transverse fuscous dots. The hindwings are light fuscous.Proceedings of the United States National Museum 116 (3495): 43 The larvae feed on Arctostaphylos species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaeotricha manzanitae has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

79Cmostly conserved

97Amostly conserved

214Gmostly conserved

628Tmostly conserved

ATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTCTTAGATTATTAATTCGAACAGAATTAGGTAACCCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antaeotricha leucillanasame genus3.4%Antaeotricha schlaegerisame genus6.6%Antaeotricha osseellasame genus7.7%Antaeotricha albulellasame genus7.7%Antaeotricha floridellasame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor5

Museum / vouchered18

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 2

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
ASUlocation not on record	3
New Haven, US	1
San Francisco, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

5 institutions · 18 of 18 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Antaeotricha manzanitae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 17.3–21.5

Seasonal swing summer↔winter17.1 °C

Max temp (day)28.7 °C 24.2–29.3

Min temp (night)11.6 °C 11.4–13.5

Precipitation6.00 mm/mo 5.60–9.80

Air humidity47.9 % 42.4–50.4

Moisture balance-166 mm/mo -175–-157

Vapour deficit1,364 Pa 1,022–1,405

Wind speed2.10 m/s 1.90–2.40

Cloud cover26.5 % 16.2–28.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)