Antaeotricha osseella

Walsingham, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Antaeotricha

At a glance

Occurrence records64

Data sources7

Biological traits0

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Antaeotricha osseella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Antaeotricha osseella is a moth of the family Depressariidae. It is found in North America, where it has been recorded from New York, New Jersey, North Carolina, South Carolina, West Virginia, Maryland, District of Columbia, Massachusetts, Pennsylvania, Illinois, Arkansas, Missouri, Texas and California. The wingspan is about 16–18 mm.mothphotographersgroup The larvae feed on Quercus alba and Quercus muehlenbergii.Antaeotricha at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaeotricha osseella has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

10Cvariable

46Cvariable

74Cvariable

82Tvariable

100Gvariable

103Tvariable

115Tvariable

124Cvariable

133Cvariable

154Tvariable

181Avariable

217Gvariable

250Tvariable

274Cvariable

340Cvariable

361Tvariable

368Gvariable

370Gvariable

401Cvariable

478Cmostly conserved

529Cvariable

653Tvariable

658Tmostly conserved

AACATTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTCTTAGATTATTAATTCGAGCAGAACTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antaeotricha albulellasame genus3.6%Antaeotricha floridellasame genus4.7%Antaeotricha schlaegerisame genus5.2%Antaeotricha leucillanasame genus7.0%Antaeotricha marmoreasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor17

Museum / vouchered47

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 7≤1 km 4≤10 km 3>10 km 1

15 georeferenced · 2 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 1≤1 km 7≤10 km 9

17 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	16
Washington, US	8
CUlocation not on record	6
Georgia Museum of Natural Historylocation not on record	5
Mississippi State, US	4
St. Paul, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Cornell University Insect Collectionlocation not on record	1

8 institutions · 45 of 47 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Antaeotricha osseella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 23.9–27.1

Seasonal swing summer↔winter14.3 °C

Max temp (day)31.4 °C 28.7–31.8

Min temp (night)22.2 °C 19.9–23.0

Precipitation182 mm/mo 129–238

Air humidity61.6 % 59.7–62.6

Moisture balance29.6 mm/mo -21.2–73.2

Vapour deficit1,277 Pa 1,210–1,371

Wind speed1.90 m/s 1.50–2.10

Cloud cover32.8 % 28.5–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)