Antaeotricha leucillana

Zeller, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Antaeotricha

At a glance

Occurrence records834

Data sources7

Biological traits0

DNA specimens67

eDNA detections78

Sources7 archives

Databases and archives Antaeotricha leucillana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility834 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF834 records

Environmental DNA1 datasets · 2 countries78 detections

DNA & barcodingBOLD67 specimens

01Narrative

Antaeotricha leucillana, the pale gray bird-dropping moth, is a moth in the family Depressariidae. It was described by Philipp Christoph Zeller in 1854. It is found in North America, where it has been recorded from New Hampshire, Massachusetts, New York, Pennsylvania, District of Columbia, Virginia, North Carolina, Georgia, Alabama, Arkansas, Missouri, Kansas, Illinois, Iowa, Texas, Oregon, Louisiana, Manitoba and Nova Scotia."Antaeotricha Zeller, 1854" at Markku Savela's Lepidoptera and Some Other Life Forms.mothphotographersgroup The wingspan is 15–23 mm. Adults have been recorded on wing from April to August in Ohio.Bug Guide The larvae feed on the leaves of Pyracantha crenulata, Malus, Vaccinium corymbosum and Acer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaeotricha leucillana has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes2

eDNA detections78

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus64 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

46Cmostly conserved

55Amostly conserved

82Cmostly conserved

217Amostly conserved

250Cmostly conserved

271Cvariable

340Cmostly conserved

370Amostly conserved

415Amostly conserved

508Gmostly conserved

523Tmostly conserved

530Cmostly conserved

542Cmostly conserved

574Cmostly conserved

616Cmostly conserved

619Amostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACCTCTCTTAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes22

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antaeotricha manzanitaesame genus3.4%Antaeotricha schlaegerisame genus6.1%Antaeotricha albulellasame genus6.8%Antaeotricha osseellasame genus7.0%Antaeotricha floridellasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type834 records

Wild obs. + sensor463

Museum / vouchered371

Range

Area of Occupancy AOO1 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 245≤1 km 68≤10 km 31>10 km 17

361 georeferenced · 102 without coordinates

Open the mapobservation + sensor463

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 9≤1 km 48≤10 km 86>10 km 27

170 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	104
East Lansing, US	58
Cambridge, US	52
New Haven, US	41
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
King Saud Universitylocation not on record	12
Washington, US	9
CUlocation not on record	8
Royal Saskatchewan Museumlocation not on record	8
St. Paul, US	8
Georgia Museum of Natural Historylocation not on record	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Decorah, US	2
Saint John, CA	2
Cornell University Insect Collectionlocation not on record	2
San Francisco, US	1
Natural History Museum of Utahlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
University of California, Davislocation not on record	1

22 institutions · 340 of 371 vouchered records shown · 31 without an institution code

09Environmental DNA78 detections

Where the DNA of Antaeotricha leucillana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map2 countries0

Temperate mixed forestGrasslandMixed Habitat1. Forest & WoodlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 13.9–25.2

Seasonal swing summer↔winter25.7 °C

Max temp (day)24.2 °C 18.0–28.1

Min temp (night)15.5 °C 10.0–23.0

Precipitation102 mm/mo 81.8–140

Air humidity58.5 % 56.7–60.8

Moisture balance-50.2 mm/mo -97.2–-1.30

Vapour deficit939 Pa 670–1,273

Wind speed3.60 m/s 2.20–6.10

Cloud cover39.2 % 30.7–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)