Anoplius toluca — The Life Data

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Anoplius

At a glance

Occurrence records125

Data sources4

Biological traits0

DNA specimens6

eDNA detections0

Sources4 archives

Databases and archives Anoplius toluca's data was compiled from.

GBIFGlobal Biodiversity Information Facility125 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF125 records

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplius toluca has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACATTATATTTTATTTTTGGTATATGATCTGGGGCTTTAGGAACTTCATTAAGAATATTAATTCGTATTGAATTAGGTAGTCCTGGTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplius ventralissame genus6.3%Anoplius insolenssame genus7.0%Anoplius virginiensissame genus10.3%Anoplius imbellissame genus10.4%Anoplius nigerrimussame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type125 records

Museum / vouchered125

Range

Area of Occupancy AOO148 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤1 km 88≤10 km 26

114 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence125

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Cruz, US	103
Santa Barbara Museum of Natural Historylocation not on record	8
US	5
Cambridge, US	2
EL PASO, US	1
University of Central Floridalocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
US	1

8 institutions · 122 of 125 vouchered records shown · 3 without an institution code